Loading ...

DNA-gold nanoparticle conjugates

How does this work?

Based on

1 Articles
2017 Most recent source

Composition

Image only illustrates the order and placement of components as described in literature.

1

gold

Type Single Compound
Formula Au
Role core
2

5'-d(TTGTCATACCATTTTCTCCAA)-(CH2)3-SH-3'

Type Biomolecule
Formula
Role layer

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  1. 9aHbroD0p20pOgrD
Product

DNA-gold nanoparticle conjugates

Diameter: 9 nm

Medium/Support: none

Method 2

Type: Physical formation
Source:
Starting materials
  1. WINRqj5W0HajeOC3
Product

DNA-gold nanoparticle conjugates

Diameter: 15 nm

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:


Sign up for a free trial