Loading ...

RNA nanostructures

Based on

10 Articles
2018 Most recent source

Composition

1

5'-r(GGGAAGCACGGACAGCGUGCAUGGUGAAGUGGACACGCCAUGCACGCUGCAGACCGAACGUGAAGGAGGCACGCGUUCGGUCUGCUAACGUGUUUCCCUCACCG)-3'

Type Biomolecule
Formula
Role framework element
2

5'-r(GGGAAGCACGGACAGCGUGCAUGGUGAAGUCCACACGCCAUGCACGCUGCAGACCGAACGUGAAGCCUGCACGCGUUCGGUCUGCUAACGUGUUUCCCGGAUGC)-3'

Type Biomolecule
Formula
Role framework element
3

5'-r(GGGAAGCACGGACAGCGUGCAUGGUGAAGCAGGCACGCCAUGCACGCUGCAGACCGAACGUGAAGCGAGCACGCGUUCGGUCUGCUAACGUGUUUCCCGACAGG)-3'

Type Biomolecule
Formula
Role framework element
4

5'-r(GGGAAGCACGGACAGCGUGCAUGGUGAAGCUCGCACGCCAUGCACGCUGCAGACCGAACGUGAAGCCUCCACGCGUUCGGUCUGCUAACGUGUUUCCCU)-3'

Type Biomolecule
Formula
Role framework element

Properties

General physical and chemical properties

Property Value Nanomaterial Variant Source
critical density

More information/entries available to subscribers only.

Or, view sample content

Sensor properties

Type of sensor Sensor property Nanomaterial Variant Source
compounds sensor for DNA

More information available to subscribers only.

Or, view sample content

Applications

Area Application Nanomaterial Variant Source
diagnostics

More information/entries available to subscribers only.

Or, view sample content

Characterization

Method Nanomaterial Variant Source
atomic force microscopy

More information/entries available to subscribers only.

Or, view sample content

Biological effects

Biological system Test details Nanomaterial Variant Source
breast cancer MCF-7 cells

More information available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • oligodeoxynucleotide/ODN
  1. yUjUe8urlv6c7M7pOBin8hBBUnBGsbD
  2. oTOp95clBNgZgDJk
  3. muvBY0F
Product

RNA nanostructures

Hydrodynamic diameter: ~ 26.2 nm

Medium: water

Support: none

Method 2

Type: Physical formation
Source:
Starting materials
  • 5'-d(AGCAAAAATGTGCTAGTGCCAAATTGCCAAATTTTCTGCTGTCTTGCTACTTGCCTTCTGCTCATTTAGTGTGAGTTCTACCATTGCCAAA)-3'
  • 5'-d(GCGGAACTTAGCCACTGTGAATTTCTGAGGAGAGCAGCGCTTGGCCAGCGCCTCTTTGCGGAACTTAGCCACTGTGAA)-3'
  • 5'-d(CTGCCTCTCCATTCGTTTTGAGCAGAAGGCAAGTAGCAGGACAGCAGATTTCACAACGTCACTCAG)-3'
See all (4)
  1. zPpJuSFF5cuFZRe6NNnr38VvhvREiCieUSEppGg7AcBd40Oe8X5XS9CI6aJa2JvMn6V4VT1gvm0DD
  2. gcggNGjg0
Product

RNA nanostructures

Size: not specified

Medium/Support: none

Method 3

Type: Physical formation
Source:
Starting materials
  • 5'-d(AGCAAAAATGTGCTAGTGCCAAATTGCCAAATTTTCTGCTGTCTTGCTACTTGCCTTCTGCTCATTTAGTGTGAGTTCTACCATTGCCAAA)-3'
  • 5'-d(GCGGAACTTAGCCACTGTGAATTTCTGAGGAGAGCAGCGCTTGGCCAGCGCCTCTTTGCGGAACTTAGCCACTGTGAA)-3'
  • 5'-d(CTGCCTCTCCATTCGTTTTGAGCAGAAGGCAAGTAGCAGGACAGCAGATTTCACAACGTCACTCAG)-3'
See all (4)
  1. RSlVByI4EnRJ3x5WfA3UZ0HD3c8jV6zSnrJ7IkAem6KCtGdwE16LxxrYZksbAflZVVsM68EmyNSjH
  2. koST8ANMb
Product

RNA nanostructures

Size: not specified

Medium/Support: none

Method 4

Type: Physical formation
Source:
Starting materials
  • 5'-d(AGTGTGAGTTCTACCATTGCCAAATTTCTGAGGAGAGCAGCGCTTGGCCAGCGCCTCTTTAGTGTGAGTTCTACCATTGCCAAA)-3'
  • 5'-d(AGTGTGAGTTCTACCATTGCCAAATTTTCTGCTGTCTTGCTACTTGCCTTCTGCTCATTTAGTGTGAGTTCTACCATTGCCAAA)-3'
  • 5'-d(CTGCCTCTCCATTCGTTTTGAGCAGAAGGCAAGTAGCAGGACAGCAGATTTCACAACGTCACTCAG)-3'
See all (4)
  1. agh1CAa2L3sfosC1uYPkgoGaW6I1vtvofiufPEwuCRLD4b84mKMFQpjkZ42YUFctlgz4EzmlSXlak
  2. eUfGv8IPq
Product

RNA nanostructures

Size: not specified

Medium/Support: none

Method 5

Type: Physical formation
Source:
Starting materials
  • 5'-d(AGCAAAAATGTGCTAGTGCCAAATTTCTGAGGAGAGCAGCGCTTGGCCAGCGCCTCTTTAGCAAAAATGTGCTAGTGCCAAAA)-3'
  • 5'-d(AGCAAAAATGTGCTAGTGCCAAATTTTCTGCTGTCTTGCTACTTGCCTTCTGCTCATTTAGCAAAAATGTGCTAGTGCCAAA)-3'
  • 5'-d(CTGAGTGACGTTGTGTTTGAGGCGCTGGCCAAGCGCTGCTCTCCTCAGTTTCGAATGGAGAGGCAG)-3'
See all (4)
  1. mXJGv1ctQjwOuV7yevffRB2mQifBe5GIH1MCdcnLfJoHkn2CO0yNDrSyrIoMnRK8cpUsD8Zjxwj9B
  2. wQnSWIsLM
Product

RNA nanostructures

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial