Loading ...

DNAzyme-functionalized nucleic acid nanocapsules

Based on

1 Articles
2017 Most recent source

Composition

1

cross-linked ammonium surfactant micelles

CM
Type Nano Material
Formula
Role core
2

5'-SH-d(TTTTTTTTTTCACGTCCAGCAG)-3'

Type Biomolecule
Formula
Role layer
3

hgd40

Type Biomolecule
Formula
Role graft
4

5'-d(GCCTCCATCCACCTGCTGGACGTG)-3'

Type Biomolecule
Formula
Role graft

Biological effects

Biological system Test details Nanomaterial Variant Source
truncated GATA-3 mRNA

More information available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  1. sHoy9V9cn8XSZH
  2. 61koya3
Product

DNAzyme-functionalized nucleic acid nanocapsules

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:


Sign up for a free trial