Loading ...

DNA-modified gold nanoparticles

Based on

1 Articles
2017 Most recent source

Composition

Image only illustrates the order and placement of components as described in literature.

1

gold nanoparticles

Au nanoparticles gold nanospheres gold NP Au NP AuNP G-NP GNP
Type Nano Material
Formula
Role core
2

thiol-modified miRNA-complimentary oligoDNA mixture

Type Complex Compound
Formula
Role layer

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • 5'-HS-(CH2)6-A15-PEG6-d(TCACAAGTTAG)-3'
  • 5'-HS-(CH2)6-PEG6-d(CTTTGAGCACTGTTAGCGTGTGTGGAATTTTAAT)-biotin-3'
  • gold nanoparticles
See all (5)
  1. NvbikBh8RZqVyohDuYAKj1aTh
  2. eO2QLTlLiDRMjCQxiFgtHC7jgbuX
  3. W0kk
  4. jr38FhnEfTdjHrOk
Product

DNA-modified gold nanoparticles

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial