Loading ...

DNA nanotube network

Based on

1 Articles
2016 Most recent source

Composition

1

d(GGCGATTAGGACGCTAAGCCACCTTTAGATCCTGTATCTGGT)

Type Biomolecule
Formula
Role raw materials
2

d(GGATCTAAAGGACCAGATACACCACTCTTCCTGACATCTTGT)

Type Biomolecule
Formula
Role raw materials
3

d(GGAAGAGTGGACAAGATGTCACCGTGAGAACCTGCAATGCGT)

Type Biomolecule
Formula
Role raw materials
4

d(GGTTCTCACGGACGCATTGCACCTAATCGCCTGGCTTAGCGT)

Type Biomolecule
Formula
Role raw materials

Properties

General physical and chemical properties

Property Value Nanomaterial Variant Source
elastic plateau modulus

More information/entries available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • d(GGAAGAGTGGACAAGATGTCACCGTGAGAACCTGCAATGCGT)
  • d(GGATCTAAAGGACCAGATACACCACTCTTCCTGACATCTTGT)
  • d(GGTTCTCACGGACGCATTGCACCTAATCGCCTGGCTTAGCGT)
See all (4)
  1. 5saRbG0LExmZTsKUt5kkS1qkRmKEhDSBdfQZzYEfT2YYb
  2. BmPNuvwMXxNZWB
Product

DNA nanotube network

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:


Sign up for a free trial