Loading ...

double-strand DNA-grafted gold nanoparticles

Based on

1 Articles
2016 Most recent source

Composition

1

gold nanoparticles

Au nanoparticles Au particles Au-particles gold NP Au NP AuNP GNP
Type Nano Material
Formula
Role core
2

4,4'-(phenylphosphinidene)bis-benzenesulfonic acid dipotassium salt

bis(p-sulfonatophenyl) phenylphosphine dihydrate dipotassium salt bis(p-sulfonatophenyl)-phenylphosphine dihydrate dipotassium salt bis-(p-sulfonatophenyl)phenylphosphine dihydrate dipotassium salt bis(p-sulfonatopheny) phenylphosphane dihydrate dipotassium salt bis(p-sulfonatophenyl)phenylphosphine dihydrate dipotassium salt bis(p-sulfonatophenyl)phenylphosphine dipotassium salt dihydrate bis(p-sulfonatophenyl)-phenylphosphine dihydrate dipotassium dipotassium bis(p-sulfonatophenyl)phenyl-phosphine dihydrate bis-p-sulfonatophenylphenyl phosphine dihydrate dipotassium potassium bis(p-sulfonatophenyl)-phenylphosphine dihydrate bis-p-sulfonatophenylphosphene dihydrate dipotassium salt bis-p-sulfonatophenylphosphine dihydrate dipotassium salt BSP phenylphosphine dihydrate dipotassium salt bis(p-sulfanatophenyl) phenylphosphine BSPP BPS SPP
Type Single Compound
Formula C18H13O6PS2*2K*2H2O
Role layer
3

[5'-desthiobiotin-d(GAGCATACATAGGGTTTCTCTTGGTTTCTT)-3']*[5'-d(AAGAAACCAAGAGAAACCCTATGTATGCTC)-SH-3']

Type Biomolecule
Formula
Role graft

Preparation

Method 1

Type: Physical formation
Source:
  1. 5O6Ky5hh
  2. uJHFr0
  3. laQcSkfc7hpPUfJhji4SwG
Product

double-strand DNA-grafted gold nanoparticles

Size: not specified

Medium/Support: none

Method 2

Type: Physical formation
Source:
  1. Y3MVnRmV
  2. K13ZVR
  3. 1pGtTR85icG6auMpWbh1V3
Product

double-strand DNA-grafted gold nanoparticles

Size: not specified

Medium/Support: none

Method 3

Type: Physical formation
Source:
  1. jKKkoiP9
  2. JIj3cy
  3. irdqBpJ50JhaXizjnRRRF3
Product

double-strand DNA-grafted gold nanoparticles

Size: not specified

Medium/Support: none

Method 4

Type: Physical formation
Source:
  1. oJDrOOVf
  2. viENDn
  3. 21xmKXzDXuglbyLBrFSIb8
Product

double-strand DNA-grafted gold nanoparticles

Size: not specified

Medium/Support: none

Method 5

Type: Physical formation
Source:
  1. P6HQ79C8
  2. PlbLOm
  3. WDrbuuWVlisAw8WZA93JAu
Product

double-strand DNA-grafted gold nanoparticles

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:


Sign up for a free trial