Loading ...

DNA hairpin-functionalized DNA nanocage

Based on

1 Articles
2016 Most recent source

Composition

1

d(TGGCTACAGTTTCGGTCAGCTTAGACATCGTTTGAATCCTATGCTCGGACGTTTGGCTCACAT)

Type Biomolecule
Formula
Role framework element
2

d(TCACGGTCCTTTCTATCCGATCGAGGCATGTTTCATACTGAGAGCGTTCCGTTTGTCATGGAA)

Type Biomolecule
Formula
Role framework element
3

d(CAGATACGCTTTCATGCCTCGATCGGATAGTTTCTGTAGCCAATGTGAGCCTTTGTCGCAGTT)

Type Biomolecule
Formula
Role framework element
4

d(CTCAGTATGTTTCGGTTACGGTACAATGCCTTTCGCAAGACGTTAGTGTCCTTTCGGAACGCT)

Type Biomolecule
Formula
Role framework element
5

d(GGTGTATCGTTTGGCATTGTACCGTAACCGTTTGCGTATCTGAACTGCGACTTTCCACCGAAT)

Type Biomolecule
Formula
Role framework element
6

d(CGTCTTGCGTTTGTATGACGCAGCACTTGCTTTCCTGGTGGCAACTCTAAGTTTGGACACTAA)

Type Biomolecule
Formula
Role framework element
7

d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)

Type Biomolecule
Formula
Role framework element
8

d(GCCACCAGGTTTCGATGTCTAAGCTGACCGTCGAATATTTATCCCCCCCCATAAATATTCCTGGACCGTGATTCCATGACTTTCTTAGAGTT)

Type Biomolecule
Formula
Role framework element

Properties

General physical and chemical properties

Property Value Nanomaterial Variant Source
horseradish peroxidase (HRP) entrapment

More information available to subscribers only.

Or, view sample content

Characterization

Method Nanomaterial Variant Source
chromatography

More information available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)
  • d(TGGCTACAGTTTCGGTCAGCTTAGACATCGTTTGAATCCTATGCTCGGACGTTTGGCTCACAT)
  • d(GCCACCAGGTTTCGATGTCTAAGCTGACCGTTTGGACCGTGATTCCATGACTTTCTTAGAGTT)
See all (8)
  1. 3pmrUzSoGG7MnxcsWrt7KZPWa9QC2gekkHKKq7OGxKHmeiT6ukVzcIHvctM
  2. rJU
  3. Y31ro4I8yTt1PwqkxnfRSL1J
Product

DNA hairpin-functionalized DNA nanocage

Size: not specified

Medium/Support: none

Method 2

Type: Chemical synthesis
Source:
Starting materials
  • d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)
  • d(GCCACCAGGTTTCGATGTCTAAGCTGACCGTCGAATATTTATCCCCCCCCATAAATATTCCTGGACCGTGATTCCATGACTTTCTTAGAGTT)
  • d(TCACGGTCCTCGAATATTTATCCCCCCCCATAAATATTCCTCTATCCGATCGAGGCATGTTTCATACTGAGAGCGTTCCGTTTGTCATGGAA)
See all (8)
  1. 2Nk4OO1v76nzkwMjC1n0gpUuJVPDwb8yKkgRPF8swbZblgGvC55lvcl3yhn
  2. niD
  3. sTTXvRKvkkskkFNtQtURwpls
Product

DNA hairpin-functionalized DNA nanocage

Size: not specified

Medium/Support: none

Method 3

Type: Chemical synthesis
Source:
Starting materials
  • d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)
  • d(CAGATACGCTTTCATGCCTCGATCGGATAGTCGAATATTTATCCCCCCCCATAAATATTCCTCTGTAGCCAATGTGAGCCTTTGTCGCAGTT)
  • d(TGGCTACAGTTTCGGTCAGCTTAGACATCGTTTGAATCCTATGCTCGGACGTTTGGCTCACAT)
See all (8)
  1. WezG59HkhL2WrIGg1BZwhzlHsZkI9w2koGJOOf3hs6RTseO3HRN1Fma5vsh
  2. lo3
  3. 2tbCjyGpxh7mWEWhsel0AqGl
Product

DNA hairpin-functionalized DNA nanocage

Size: not specified

Medium/Support: none

Method 4

Type: Chemical synthesis
Source:
Starting materials
  • d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)
  • d(GCCACCAGGTTTCGATGTCTAAGCTGACCGTCGAATATTTATCCCCCCCCATAAATATTCCTGGACCGTGATTCCATGACTTTCTTAGAGTT)
  • d(GGTGTATCGTTTGGCATTGTACCGTAACCGTTTGCGTATCTGAACTGCGACTTTCCACCGAAT)
See all (8)
  1. W9d0AOirKOaROGf9ELIDDOXmI8PPZiRt20GrbjkS0sF0JaMrFjff7qEdEWN
  2. 7wT
  3. 9c1MhouKlZm8kgYqlWmBy8Ec
Product

DNA hairpin-functionalized DNA nanocage

Size: not specified

Medium/Support: none

Method 5

Type: Chemical synthesis
Source:
Starting materials
  • d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)
  • d(TGGCTACAGTTTCGGTCAGCTTAGACATCGTTTGAATCCTATGCTCGGACGTTTGGCTCACAT)
  • d(GCCACCAGGTTTCGATGTCTAAGCTGACCGTCGAATATTTATCCCCCCCCATAAATATTCCTGGACCGTGATTCCATGACTTTCTTAGAGTT)
See all (8)
  1. b3aLRG5ilqAuAwD7gWA0FznHDP8E4rYctJUWLqRCcplbQfGGsHv58e51cE8
  2. 4hY
  3. u1jlOswiuPsYruJpwBxtWVMG
Product

DNA hairpin-functionalized DNA nanocage

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial