Loading ...

DNA-functionalized gold nanoparticles

Based on

1 Articles
2015 Most recent source

Composition

1

gold

Type Single Compound
Formula Au
Role core
2

[5'-d(AACAATTATACTCAGCAA)-3'-[(C2H4O)6PO3]2OC3H6SH]*[5'-d(TTGCTGAGTATAATTGTTATTGCTGAGTATAATTGTTATTTAGTCACGACGAGTCATTTTTAGTCACGACGAGTCATTATTTCCTTT)-3']*[5'-d(AATGACTCGTCGTGACTAAAAATGACTCGTCGTGACTAAA)-3']

Type Biomolecule
Formula
Role layer

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • 5'-d(AATGACTCGTCGTGACTAAAAATGACTCGTCGTGACTAAA)-3'
  • 5'-d(TTGCTGAGTATAATTGTTATTGCTGAGTATAATTGTTATTTAGTCACGACGAGTCATTTTTAGTCACGACGAGTCATTATTTCCTTT)-3'
  1. 5rrUytHenL34
Product

DNA-functionalized gold nanoparticles

Diameter: 10 nm

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:


Sign up for a free trial