Loading ...

DNA nanotubes

Based on

1 Articles
2015 Most recent source

Composition

Image only illustrates the order and placement of components as described in literature.

1

hybridized DNA oligonucleotide construct

Type Complex Compound
Formula
Role raw materials

Properties

General physical and chemical properties

Property Value Nanomaterial Variant Source
fluorescence melting curve

More information/entries available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • 5'-d(TCGAAGTCGTATTCGAGTTCAAATGTCTATGCGATGCAGCAT)-3'
  • 5'-d(CGACATTAAATAAAAAAGATGAGTATTT)-3'
  • 5'-d(CGTTATGTATGACGCTAAACCTTGCAATGACTGAACTCGAAT)-3'
See all (24)
  1. FtId2tFEF2AyzPMb
  2. eQZJ
  3. f8igNuw9nlzxBDID
  4. 1W3hU9v
Product

DNA nanotubes

Length: 27 nm

Outer diameter: 8.5 nm

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial