Loading ...

Mu peptide-condensed, FAM-Dz-13/ROX-OGX-427-loaded 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

Based on

1 Articles
2015 Most recent source

Composition

1

FAM-Dz-13/ROX-OGX-427-loaded 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

Type Nano Material
Formula
Role core
2

adenovirus core complex-derived Mu peptide

adenovirus-derived Mu peptide
Type Biomolecule
Formula
Role layer

Biological effects

Biological system Test details Nanomaterial Variant Source
human epidermal carcinoma KB cells

More information available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • 5'-TATATACTAGTCAGATATTACT-3' oligodeoxynucleotide
  1. qkGApzDEDSg1iaJO86IB7ww4tKKRpDkUv6XjGZbXSv38tYHgLjrQoA36uZAYvOFyP7rBaZmtvpBsrC0i88pQ2JjcPojYKc5ISJnFbfAtVSZPz8PC
  2. zwj29ovUorfSIuQrt5k29KqeQ
  3. fNNvpL
Product

Mu peptide-condensed, FAM-Dz-13/ROX-OGX-427-loaded 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:


Sign up for a free trial