Loading ...

square-shaped RNA nanoarchitecture mix

Based on

1 Articles
2014 Most recent source

Composition

Image only illustrates the order and placement of components as described in literature.

1

square-shaped RNA nanoarchitectures

RNA square nanoparticles
Type Nano Material
Formula
Role raw materials
2

square-shaped RNA nanoarchitectures

RNA square nanoparticles
Type Nano Material
Formula
Role raw materials
3

square-shaped RNA nanoarchitectures

RNA square nanoparticles
Type Nano Material
Formula
Role raw materials

Characterization

Method Nanomaterial Variant Source
atomic force microscopy

More information/entries available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • 5'-GGCAUGUGUGACCAUGUGUACUCAUGUGUGCUCAUGUGUU-3'
  • 5'-GGACACUUGUCAUGUGUAUGAGCGUCCUCGUGGCAACUCGUCCGUGUGUAUUGUCAUGUGUAUGGAUGCAUAGGUCGACUAUGCCACUCUAUCGUUGUCAUGUGUAUGCGAAGGACUACGACACGGAAUGCGAUGCGCUUGUCAUGUGUAUGGCAGGCUAUCCGAGCUAUGCUUGC-3'
  • TMS buffer
See all (14)
  1. ypK6
  2. eu8Sv
Product

square-shaped RNA nanoarchitecture mix

Size: not specified

Medium: TMS buffer

Support: none

Method 2

Type: Chemical synthesis
Source:
Starting materials
  • 5'-GGCAUGUGUGACCAUGUGUACUCAUGUGUGCUCAUGUGUU-3'
  • 5'-GGACACUUGUCAUGUGUAUGAGCGUCCUCGUGGCAACUCGUCCGUGUGUAUUGUCAUGUGUAUGGAUGCAUAGGUCGACUAUGCCACUCUAUCGUUGUCAUGUGUAUGCGAAGGACUACGACACGGAAUGCGAUGCGCUUGUCAUGUGUAUGGCAGGCUAUCCGAGCUAUGCUUGC-3'
  • 5'-GGGAGGUCGCAAUCAUGGUACUUUGUUGGCUGGAC-3'
See all (13)
  1. yXfTvKiTcM
  2. xiXN
  3. s6wnP
Product

square-shaped RNA nanoarchitecture mix

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial