Loading ...

RNA nanostructures

Based on

10 Articles
2018 Most recent source

Composition

1

5'-r(GGGCUAACGCAGACCGAUGAAGGAGGCACGUCGGUCUGCGGACAGCCGUGCAUUGAAGUGGACACGAUGCACGGCUGCCCGGUGUC)-3'

Type Biomolecule
Formula
Role framework element
2

5'-r(GGGCUAACGCAGACCGAUGAAGUCCACACGUCGGUCUGCGGACAGCCGUGCAUUGAAGCCUGCACGAUGCACGGCUGCCCCCUGUC)-3'

Type Biomolecule
Formula
Role framework element
3

5'-r(GGGAUGGCUAACGCAGACCGAUGAAGCCUCCACGUCGGUCUGCGGACAGCCGUGCAUUGAAGCAGGCACGAUGCACGGCUGCCAUCCCUCACCG)-3'

Type Biomolecule
Formula
Role framework element

Properties

General physical and chemical properties

Property Value Nanomaterial Variant Source
band gap

More information/entries available to subscribers only.

Or, view sample content

Catalytic properties

Reaction Value Nanomaterial Variant Source
hydrogen evolution reaction

More information available to subscribers only.

Or, view sample content

Applications

Area Application Nanomaterial Variant Source
catalysis

More information/entries available to subscribers only.

Or, view sample content

Characterization

Method Nanomaterial Variant Source
atomic force microscopy

More information/entries available to subscribers only.

Or, view sample content

Biological effects

Biological system Test details Nanomaterial Variant Source
C57BL/6J female mouse

More information/entries available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • 5'-r(GGGCUAACGCAGACCGAUGAAGUCCACACGUCGGUCUGCGGACAGCCGUGCAUUGAAGCCUGCACGAUGCACGGCUGCCCCCUGUC)-3'
  • 5'-r(GGGCUAACGCAGACCGAUGAAGGAGGCACGUCGGUCUGCGGACAGCCGUGCAUUGAAGUGGACACGAUGCACGGCUGCCCGGUGUC)-3'
  • 5'-r(GGGAUGGCUAACGCAGACCGAUGAAGCCUCCACGUCGGUCUGCGGACAGCCGUGCAUUGAAGCAGGCACGAUGCACGGCUGCCAUCCCGGAUGC)-3'
  1. htjJsRFSHb0YvZ
Product

RNA nanostructures

Size: ~ 10 nm

Medium/Support: none

Method 2

Type: Chemical synthesis
Source:
Starting materials
  • single-stranded deoxyribonucleic acid
  • biotin-labeled deoxyribonucleic acid
  1. sbQ7hP9UIqVEq8zwDnvDc8GNeDflTabqFgfgjaJDbfZ0f5Iqh
Product

RNA nanostructures

Height: 68 - 96 nm

Length: 84 - 104 nm

Width: 72 - 96 nm

Medium: none

Support: streptavidin-modified glass

Method 3

Type: Physical formation
Source:
Starting materials
  • 5'-r(GGGCUAACGCAGACCGAUGAAGUCCACACGUCGGUCUGCGGACAGCCGUGCAUUGAAGCCUGCACGAUGCACGGCUGCCCUCACCG)-3'
  • 5'-r(GGGAUGGCUAACGCAGACCGAUGAAGCCUCCACGUCGGUCUGCGGACAGCCGUGCAUUGAAGCAGGCACGAUGCACGGCUGCCAUCCCGCAUCC)-3'
  • 5'-r(GGGCUAACGCAGACCGAUGAAGGAGGCACGUCGGUCUGCGGACAGCCGUGCAUUGAAGUGGACACGAUGCACGGCUGCCCGGAUGC)-3'
  1. CvqFdjVGfqkFsI
Product

RNA nanostructures

Size: ~ 10 nm

Medium/Support: none

Method 4

Type: Physical formation
Source:
Starting materials
  • 5'-r(GGGCUAACGCAGACCGAUGAAGUCCACACGUCGGUCUGCGGACAGCCGUGCAUUGAAGCCUGCACGAUGCACGGCUGCCCUCACCG)-3'
  • 5'-r(GGGCUAACGCAGACCGAUGAAGGAGGCACGUCGGUCUGCGGACAGCCGUGCAUUGAAGUGGACACGAUGCACGGCUGCCCGGAUGC)-3'
  • 5'-r(GGGCUAACGCAGACCGAUGAAGCAGGCACGUCGGUCUGCGGACAGCCGUGCAUUGAAGCCUCCACGAUGCACGGCUGCCCGACAGG)-3'
  1. QBnsPac0keuDfM
Product

RNA nanostructures

Size: ~ 10 nm

Medium/Support: none

Method 5

Type: Chemical synthesis
Source:
Starting materials
  • enhanced green fluorescent protein
  • acetyltransferase-N-terminal glutathione S-transferase fusion protein
  1. P8tuQalwNOmXe9enju
  2. hx9Q
  3. o4f1wBBmLqCYX2DUAFgxhzDkdNQst
Product

RNA nanostructures

Hydrodynamic diameter: 100 - 150 nm

Medium: phosphate buffer solution

Support: none

References

Full content is available to subscribers only

To view content please choose from the following:


Sign up for a free trial