Loading ...

RNA nanostructures

Based on

4 Articles
2018 Most recent source

Composition

1

oligodeoxynucleotide/ODN

Type Biomolecule
Formula
Role framework element
2

oligodeoxynucleotide/ODN

Type Biomolecule
Formula
Role framework element
3

oligodeoxynucleotide/ODN

Type Biomolecule
Formula
Role framework element
4

oligodeoxynucleotide/ODN

Type Biomolecule
Formula
Role framework element
5

oligodeoxynucleotide/ODN

Type Biomolecule
Formula
Role framework element
6

oligodeoxynucleotide/ODN

Type Biomolecule
Formula
Role framework element

Properties

General physical and chemical properties

Property Value Nanomaterial Variant Source
melting point

More information available to subscribers only.

Or, view sample content

Applications

Area Application Nanomaterial Variant Source
diagnostics

More information/entries available to subscribers only.

Or, view sample content

Characterization

Method Nanomaterial Variant Source
atomic force microscopy

More information/entries available to subscribers only.

Or, view sample content

Biological effects

Biological system Test details Nanomaterial Variant Source
CCRF-CEM cells

More information/entries available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • oligodeoxynucleotide/ODN
  1. zaC3DkdPDYdxmMi8DVMZ9Rf4N2cGPJx
  2. Nt4AWzDNe647GERx
  3. b2nt68d
Product

RNA nanostructures

Hydrodynamic diameter: ~ 29.7 nm

Medium/Support: none

Method 2

Type: Physical formation
Source:
Starting materials
Product

RNA nanostructures

Hydrodynamic diameter: ~ 29.7 nm

Medium: water

Support: none

Method 3

Type: Physical formation
Source:
Starting materials
  • 5'-r(GGGAAUUCGAGGACUGGUCUGGACAGCGACUGAAGGAGGCACGGUCGCUGCAGGCAUGAAGCUCGCACGUGCUUGCUAACAGAUCAGUUCUCGAGCCUUGGUGU)-3'
  • 5'-r(GGGAAUUCGACGUCGCUGCAGUUCCUGGACCACGUGAAGCCUGCACGCGUGGUUCAGGGACUGCUAACAGAUCAUCGUACGCAACGGUGAAGAACGCACGCCGUUAGCGUGCGAUGGUCUGGACAGCGGCGUCGAGCCAAGGUGU)-3'
  • 5'-r(GGAAGGGAAACGUACCGGAUCAACGUACGCAACGGUGAAGUCACCACGCCGUUAGCGUGCGUUGGUCUGGUACGCUAAGCUGAGACCACGUGAGACCACGACGCGUGGUUUCAGUAUGUCUUCUU)-3'
See all (6)
  1. Avo3p1Ybxaludr
Product

RNA nanostructures

Length: ~ 25.8 nm

Width: ~ 23.8 nm

Medium/Support: none

Method 4

Type: Physical formation
Source:
Starting materials
  • 5'-r(GGGACAGGGAAACGUGAGACCGUUGGCUUGGCAAUUGUGAAGUCCACACGCAAUUAGCCAAGCUAACGGUCUCACGCCGAUCCUUGAGGUCGUGAAGCCUGCACGCGAUCUCAAGGAUCGGUCUGUCCUU)-3'
  • 5'-r(GGGGAGGGAAACGUGGCGGCUUGGCUGAAUGAAGUGGACACGUUCAGCCAAGGGAAGAAACUGCGCCACGCCGAGGGAAGAAACUGCGACGUGAAGCCUCCACGCGUCGGCUCGGUCUCCCCU)-3'
  • 5'-r(GGGACCUCCGUGGUUCGAAUCCACGUACUAGCCUGGAUGAAUUCCCAGUGAAGCAGGCACGCUGGGAGUUCGUCCAGGCUGGUAUGGCCGAGCGGCUGAAGGCACUCCGACGCGGUCUGCGCUGAAGCAGGCACGGCGUAGGCCGCGUUGGAGUAGGUCCCU)-3'
See all (4)
  1. e1EukJf7JsAHV2
Product

RNA nanostructures

Length: ~ 28.5 nm

Width: ~ 27.8 nm

Medium/Support: none

Method 5

Type: Physical formation
Source:
Starting materials
  • 5'-r(GGGACGGACAGCGUGCAUGGUGAAGUCCACACGCCAUGCACGCUGCAGACCGAACGUGAAGCCUGCACGCGUUCGGUCUGCUAACGUUCCU)-3'
  • 5'-r(GGGACGGACAGCGUGCAUGGUGAAGGAGGCACGCCAUGCACGCUGCAGACCGAACGUGAAGUGGACACGCGUUCGGUCUGCUAACGUUCCU)-3'
  • 5'-r(GGGACGGACAGCGUGCAUGGUGAAGCAGGCACGCCAUGCACGCUGCAGACCGAACGUGAAGCCUCCACGCGUUCGGUCUGCUAACGUUCCU)-3'
  1. tC60HrSCUpqJMn
Product

RNA nanostructures

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial