Loading ...

DNA nanocages

Based on

1 Articles
2015 Most recent source

Composition

1

TTACCGTGTGGTTGCTAGTTA

Type Biomolecule
Formula
Role raw materials
2

TAGCAACCTGCCTGGCAAGCCTACGATGGACACGGTAACGCC

Type Biomolecule
Formula
Role raw materials
3

AGGCACCATCGTAGGTTTAACTTGCCAGGCACCATCGTAGGTTTAACTTGCCAGGCACCATCGTAGGTTTAACTTGCC

Type Biomolecule
Formula
Role raw materials
4

TAGCAACCTGCCTGGCAAGCCTACGATGGACACGGTAATAAC

Type Biomolecule
Formula
Role raw materials
5

GCCAGGCACCATCGTAGGCTTTTCCTCAAGA

Type Biomolecule
Formula
Role raw materials
6

TTACCGTGTGGTTGCTAGGCG

Type Biomolecule
Formula
Role raw materials

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • TAGCAACCTGCCTGGCAAGCCTACGATGGACACGGTAATAAC
  • TTACCGTGTGGTTGCTAGTTA
  • AGGCACCATCGTAGGTTTAACTTGCCAGGCACCATCGTAGGTTTAACTTGCCAGGCACCATCGTAGGTTTAACTTGCC
See all (6)
  1. PdpBh
  2. 5ZCi
  3. aIWUtJxfBJR
  4. 1lG7
  5. heExfZpNlPdjaOfNQ
  6. Y1Uv
Product

DNA nanocages

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial