Loading ...

amino-modified probe ssDNA-functionalized carboxyl-terminated nanocrystalline diamond film

Based on

1 Articles
2014 Most recent source

Composition

Image only illustrates the order and placement of components as described in literature.

1

carboxyl-terminated nanocrystalline diamond film

NCD:COOH
Type Nano Material
Formula
Role raw materials
2

NH2-modified single-strand DNA

NH2-modified ssDNA
Type Biomolecule
Formula
Role layer

Applications

Area Application Nanomaterial Variant Source
diagnostics

More information/entries available to subscribers only.

Or, view sample content

Biological effects

Biological system Test details Nanomaterial Variant Source
target ssDNA fragment 5'-AGGAACTTTGCTGCCACAATACCTCGGCCCTTCTCAGTTCGCTACGACCCATAC ACCCAAAGGATTGAGGTCTTGGACAATACCCAGCAGCTTAAGATTTTGGCTGA TTCCATTAACAGTAAG-3' with mutation c.1222C>T

More information/entries available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  1. R5r0ScnPazHjzu10ah38OtZGUIHfaIS9I3mI7x5n1nbhi
Product

amino-modified probe ssDNA-functionalized carboxyl-terminated nanocrystalline diamond film

Size: not specified

Medium/Support: none

Method 2

Type: Chemical synthesis
Source:
Starting materials
  1. 7K5ZzToXkAFwZXTopTHxSduwIS7PC8khzTvr7Uf2QoyVx
Product

amino-modified probe ssDNA-functionalized carboxyl-terminated nanocrystalline diamond film

Size: not specified

Medium/Support: none

Method 3

Type: Chemical synthesis
Source:
Starting materials
  1. bm7hVwhHDCMXZdKq2mtSjfWY6klZDmt167kA2I0Ei7tEB
Product

amino-modified probe ssDNA-functionalized carboxyl-terminated nanocrystalline diamond film

Size: not specified

Medium/Support: none

Method 4

Type: Chemical synthesis
Source:
Starting materials
  1. gsA2Khsq3RVN4MzutYr63xOEFnlyouBCYpaJbppZD5Imv
Product

amino-modified probe ssDNA-functionalized carboxyl-terminated nanocrystalline diamond film

Size: not specified

Medium/Support: none

Method 5

Type: Chemical synthesis
Source:
Starting materials
  1. gRPouYSWK7c1k2EDSaiJB6BiQRRTQACuCnL6F3pkabxZx
Product

amino-modified probe ssDNA-functionalized carboxyl-terminated nanocrystalline diamond film

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial