Loading ...

deoxyribonucleic acid tetrahedrons

Based on

13 Articles
2018 Most recent source

Composition

1

DNA strand

Type Biomolecule
Formula
Role framework element
2

DNA strand

Type Biomolecule
Formula
Role framework element
3

DNA strand

Type Biomolecule
Formula
Role framework element
4

DNA strand

Type Biomolecule
Formula
Role framework element

Properties

General physical and chemical properties

Property Value Nanomaterial Variant Source
acoustic ratio dependent on tetrahedron state

More information/entries available to subscribers only.

Or, view sample content

Sensor properties

Type of sensor Sensor property Nanomaterial Variant Source
compounds sensor in exosomes from human liver hepatocellular HepG2 cells

More information available to subscribers only.

Or, view sample content

Applications

Area Application Nanomaterial Variant Source
diagnostics

More information/entries available to subscribers only.

Or, view sample content

Characterization

Method Nanomaterial Variant Source
atomic force microscopy

More information/entries available to subscribers only.

Or, view sample content

Biological effects

Biological system Test details Nanomaterial Variant Source
C57BL/6 mouse

More information/entries available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • single-stranded deoxyribonucleic acid
  1. f33QSI88WN5I22BfBDwJ
  2. 6sPoQ
Product

deoxyribonucleic acid tetrahedrons

Size: not specified

Medium/Support: none

Method 2

Type: Chemical synthesis
Source:
Starting materials
  • deoxyribonucleic acid
  1. H23tbahY0kZKKVCELK4xiEUmxKzpTZV2
  2. KfVvT21noZhsqjHwtC6pWom0VeT1LvZ1QtBuCSEYyx282
  3. 7cRPMmA
Product

deoxyribonucleic acid tetrahedrons

Height: ~ 2 - 3 nm

Width: ~ 17 nm

Medium/Support: none

Method 3

Type: Physical formation
Source:
Starting materials
  • gold
  • deoxyribonucleic acid
Product

deoxyribonucleic acid tetrahedrons

Size: not specified

Medium: none

Support: gold

Method 4

Type: Physical formation
Source:
Starting materials
  • deoxyribonucleic acid
  1. GaXO8qA4Li3iB52
  2. sex1sGk
Product

deoxyribonucleic acid tetrahedrons

Width: ~ 17 nm

Medium/Support: none

Method 5

Type: Physical formation
Source:
Starting materials
  • 5'-d(CCCCCCCTAACCCCCCCTAACCCCCCCTAACCCCCCCATACTGTAATCGACGGGAAGAGCATGCCCATCCACTACTATGGCGGGTGATAAA)-3'
  • 5'-d(TATTTTGTTATGTGTTATGTGTTATATTCAGACTTAGGAATGTTCGACATGCGAGGGTCCAATACCG)-3'
  • 5'-d(CCTCGCATGACTCAACTGCCTTGGTGATACGAGGATGGGCATGCTCTTCCCGACGGTATTGGAC)-3'
See all (5)
  1. tf3n4KhmBoEx2uxyO
Product

deoxyribonucleic acid tetrahedrons

Size: not specified

Medium: TM buffer

Support: none

References

Full content is available to subscribers only

To view content please choose from the following:


Sign up for a free trial