Loading ...

Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

folic acid-functionalized monomolecular nucleic acid/lipid particles

Based on

1 Articles
2017 Most recent source

Composition

1

[5'-ATTO488-d(CCAACAGTAAAAGGAATATCC)-3']*[5'-ATTO488-d(GGATATTCCTTTTACTGTTGG)-3']

Type Biomolecule
Formula
Role core
2

DOTAP/DOPE

Type Complex Compound
Formula
Role layer
3

DOPC/DSPE-PEG(2000)/DSPE-PEG(2000)-FolA

Type Complex Compound
Formula
Role layer

Properties

Applications

Area Application Nanomaterial Variant Source
drug delivery

More information available to subscribers only.

Or, view sample content

Characterization

Biological effects

Biological system Test details Nanomaterial Variant Source
wild-type human cervix carcinoma KB cells

More information available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine
  • 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] ammonium salt
  • (9Z)-9-Octadecenoic acid (1R)-1-[[[(2-aminoethoxy)hydroxyphosphinyl]oxy]methyl]-1,2-ethanediyl ester
See all (5)
  1. dLSrpP5dIflA3OOXyL2
  2. a7AR4dKYiKNjf
Product

folic acid-functionalized monomolecular nucleic acid/lipid particles

Size: not specified

Medium: water

Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial