Loading ...

DNA-functionalized gold nanoparticles

Based on

1 Articles
2017 Most recent source

Composition

1

gold nanoparticles

Au nanoparticles gold NP Au NP AuNP GNP
Type Nano Material
Formula
Role raw materials
2

thiol-modified 5'-d(TTTGAGTCCGTCGGACGATGCGTAGATTCCTTTCGCGCACCTGAGACCTTCTAATAGGGTTTGCGACAGTCGTTCAACTAGAATGCCC)-3'

Type Biomolecule
Formula
Role graft

Properties

Applications

Characterization

Biological effects

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • thiol-modified 5'-d(TTTGAGTCCGTCGGACGATGCGTAGATTCCTTTCGCGCACCTGAGACCTTCTAATAGGGTTTGCGACAGTCGTTCAACTAGAATGCCC)-3'
  • gold nanoparticles
  1. h1LuXURcbKqvdvhJgGEnVjtY
  2. pBCQ9KPgO8gR
Product

DNA-functionalized gold nanoparticles

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial