Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

DNA-modified silver-coated gold nanoparticles

Based on

1 Articles
2017 Most recent source

Composition

Image only illustrates the order and placement of components as described in literature.

1

silver-coated gold nanoparticles

B-NP
Type Nano Material
Formula
Role core
2

thiol-modified miRNA-complimentary oligoDNA mixture

Type Complex Compound
Formula
Role layer

Properties

General physical and chemical properties

Property Value Source
photostability

More information available to subscribers only.

Or, view sample content

Applications

Characterization

Biological effects

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • 5'-biotin-d(TAATTTTAAGGTGTGTGCGATTGTCACGAGTTTC)-PEG6-(CH2)3-SH-3'
  • 5'-d(TTCAGTTCTCA)-PEG6-A15-(CH2)3-SH-3'
  • 5'-d(ATTAGCATTAA)-PEG6-A15-(CH2)3-SH-3'
See all (5)
  1. G4b1MBDFC4Z5DqFqdp26IUe36
  2. EsAbwfHroAtpSWE4GHZ8eREogxt0
  3. WFYU
  4. ZeLJaaB9rhse5W8T
Product

DNA-modified silver-coated gold nanoparticles

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial