Loading ...

Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

DNA-modified silver-coated gold nanorods

Based on

1 Articles
2017 Most recent source

Composition

Image only illustrates the order and placement of components as described in literature.

1

silver-coated gold nanorods

R-NP
Type Nano Material
Formula
Role core
2

thiol-modified miRNA-complimentary oligoDNA mixture

Type Complex Compound
Formula
Role layer

Properties

Applications

Characterization

Biological effects

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • 5'-HS-(CH2)6-A15-PEG6-d(GAAACCCAGCA)-3'
  • 5'-HS-(CH2)6-PEG6-d(CTTTGAGCACTGTTAGCGTGTGTGGAATTTTAAT)-biotin-3'
  • 5'-HS-(CH2)6-A15-PEG6-d(CAGACTCCGGT)-3'
See all (5)
  1. PQ0btn6STR4JIaw7f9zOXmL0E
  2. 0TGyUdP0QOfbV5Nv4WrdSS8RRLg1
  3. wFds
  4. 9ZG5lPwrrBA7eJfA
Product

DNA-modified silver-coated gold nanorods

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial