Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

PNA/DNA-loaded poly(lactic-co-glycolic acid) nanoparticles

Based on

1 Articles
2016 Most recent source

Composition

1

poly(lactic-co-glycolic acid)

PLGA
Type Polymer
Formula
Role carriers
2

H-KKK-TTTJTJJ-OOO-CCTCTTTGCACCATTCT-KKK-NH2

Type Biomolecule
Formula
Role loaded material
3

5'-d(AAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATAT)-3'

Type Biomolecule
Formula
Role loaded material

Properties

General physical and chemical properties

Property Value Source
Zeta potential

More information available to subscribers only.

Or, view sample content

Applications

Area Application Source
drug delivery

More information available to subscribers only.

Or, view sample content

Characterization

Method Source
dynamic light scattering

More information available to subscribers only.

Or, view sample content

Biological effects

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • poly(lactic-co-glycolic acid)
  1. NUu4j56dDCAc4MNti0x2NFmi
Product

PNA/DNA-loaded poly(lactic-co-glycolic acid) nanoparticles

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial