Loading ...

Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

DNA nanotube network

Based on

1 Articles
2016 Most recent source

Composition

1

d(GGCGATTAGGACGCTAAGCCACCTTTAGATCCTGTATCTGGT)

Type Biomolecule
Formula
Role raw materials
2

d(GGATCTAAAGGACCAGATACACCACTCTTCCTGACATCTTGT)

Type Biomolecule
Formula
Role raw materials
3

d(GGAAGAGTGGACAAGATGTCACCGTGAGAACCTGCAATGCGT)

Type Biomolecule
Formula
Role raw materials
4

d(GGTTCTCACGGACGCATTGCACCGCACGACCTGTTCGACAGT)

Type Biomolecule
Formula
Role raw materials
5

d(GGTCGTGCGGACTGTCGAACACCAACGATGCCTGATAGAAGT)

Type Biomolecule
Formula
Role raw materials
6

d(GGCATCGTTGGACTTCTATCAATGCACCTCCAGCTTTGAATG)

Type Biomolecule
Formula
Role raw materials
7

d(GGAGGTGCATCATTCAAAGCTAACGGTAACTATGACTTGGGA)

Type Biomolecule
Formula
Role raw materials
8

d(TAGTTACCGTTTCCCAAGTCAAACACTAGACACATGCTCCTA)

Type Biomolecule
Formula
Role raw materials
9

d(GTCTAGTGTTTAGGAGCATGTCGAGACTACACCCTTGCCACC)

Type Biomolecule
Formula
Role raw materials
10

d(TGTAGTCTCGGGTGGCAAGGGTACTACCGCTCCATTAAGAAT)

Type Biomolecule
Formula
Role raw materials
11

d(AGCGGTAGTAATTCTTAATGGATCCGTCTATCTACACTATCA)

Type Biomolecule
Formula
Role raw materials
12

d(ATAGACGGATTGATAGTGTAGAGACGAAATCAGCAGAACTAA)

Type Biomolecule
Formula
Role raw materials
13

d(GATTTCGTCTTTAGTTCTGCTCTGCGAAGTAATCAGCCGAGC)

Type Biomolecule
Formula
Role raw materials
14

d(TTACTTCGCAGGCTCGGCTGACCTAATCGCCTGGCTTAGCGT)

Type Biomolecule
Formula
Role raw materials

Properties

General physical and chemical properties

Property Value Nanomaterial Variant Source
elastic plateau modulus

More information/entries available to subscribers only.

Or, view sample content

Applications

Characterization

Biological effects

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • d(GGAGGTGCATCATTCAAAGCTAACGGTAACTATGACTTGGGA)
  • d(GATTTCGTCTTTAGTTCTGCTCTGCGAAGTAATCAGCCGAGC)
  • d(TAGTTACCGTTTCCCAAGTCAAACACTAGACACATGCTCCTA)
See all (14)
  1. eOc9U3Ut3lnuSHfYZEOvoUvfBW7TykJ9Dhpns2WcLYW6b
  2. 64tBybWyEY6vJ7
Product

DNA nanotube network

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial