Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

PNA/DNA-loaded poly(lactic-co-glycolic acid) nanoparticles

Based on

1 Articles
2016 Most recent source

Composition

1

poly(lactic-co-glycolic acid)

PLGA
Type Polymer
Formula
Role carriers
2

H-KKK-JTTTJTTTJTJT-OOO-TCTCTTTCTTTCAGGGCA-KKK-NH2

Type Biomolecule
Formula
Role loaded material
3

5'-d(AAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATAT)-3'

Type Biomolecule
Formula
Role loaded material

Properties

General physical and chemical properties

Property Value Source
drug release

1 more entry available to subscribers only.

Or, view sample content

Applications

Area Application Source
drug delivery

0 more entry available to subscribers only.

Or, view sample content

Characterization

Method Source
dynamic light scattering

1 more entry available to subscribers only.

Or, view sample content

Biological effects

Biological system Test details Source
bone marrow cells from β-globin/GFP transgenic mouse

2 more entries available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • poly(lactic-co-glycolic acid)
  1. YXSznF3OGAOZWBKPYIOU7Ueu
Product

PNA/DNA-loaded poly(lactic-co-glycolic acid) nanoparticles

Method 2

Type: Physical formation
Source:
Starting materials
  • poly(lactic-co-glycolic acid)
  1. DCwy7qzShKo2UAWCYPwhpKt0
Product

PNA/DNA-loaded poly(lactic-co-glycolic acid) nanoparticles

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial