Loading ...

PNA/DNA-loaded poly(lactic-co-glycolic acid) nanoparticles

Based on

1 Articles
2016 Most recent source

Composition

1

poly(lactic-co-glycolic acid)

PLGA
Type Polymer
Formula
Role carriers
2

H-KKK-JTTTJTTTJTJT-OOO-TCTCTTTCTTTCAGGGCA-KKK-NH2

Type Biomolecule
Formula
Role loaded material
3

5'-d(AAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATAT)-3'

Type Biomolecule
Formula
Role loaded material

Properties

General physical and chemical properties

Property Value Nanomaterial Variant Source
drug release

More information/entries available to subscribers only.

Or, view sample content

Applications

Area Application Nanomaterial Variant Source
drug delivery

More information available to subscribers only.

Or, view sample content

Characterization

Method Nanomaterial Variant Source
dynamic light scattering

More information/entries available to subscribers only.

Or, view sample content

Biological effects

Biological system Test details Nanomaterial Variant Source
bone marrow cells from β-globin/GFP transgenic mouse

More information/entries available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • poly(lactic-co-glycolic acid)
  1. zGLfVU4xKMC8ZPIMsE25PAIQ
Product

PNA/DNA-loaded poly(lactic-co-glycolic acid) nanoparticles

Size: 182.4 - 357.6 nm

Medium/Support: none

Method 2

Type: Physical formation
Source:
Starting materials
  • poly(lactic-co-glycolic acid)
  1. KbRFURXeOd6zHYddDv4NWiAx
Product

PNA/DNA-loaded poly(lactic-co-glycolic acid) nanoparticles

Hydrodynamic diameter: 293.1 nm

Size: 182.4 - 357.6 nm

Medium: phosphate buffer solution

Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial