Loading ...

DNA nanotubes

Based on

1 Articles
2016 Most recent source

Composition

1

Cy3-d(TTGGCGATTAGGACGCTAAGCCACCTTTAGATCCTGTATCTGGT)

Type Biomolecule
Formula
Role raw materials
2

d(GGATCTAAAGGACCAGATACACCACTCTTCCTGACATCTTGT)

Type Biomolecule
Formula
Role raw materials
3

d(GGAAGAGTGGACAAGATGTCACCGTGAGAACCTGCAATGCGT)

Type Biomolecule
Formula
Role raw materials
4

d(GGTTCTCACGGACGCATTGCACCGCACGACCTGTTCGACAGT)

Type Biomolecule
Formula
Role raw materials
5

d(GGTCGTGCGGACTGTCGAACACCTAATCGCCTGGCTTAGCGT)

Type Biomolecule
Formula
Role raw materials

Properties

Applications

Characterization

Method Nanomaterial Variant Source
fluorescence microscopy

More information available to subscribers only.

Or, view sample content

Biological effects

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • d(GGTCGTGCGGACTGTCGAACACCTAATCGCCTGGCTTAGCGT)
  • d(GGATCTAAAGGACCAGATACACCACTCTTCCTGACATCTTGT)
  • d(GGTTCTCACGGACGCATTGCACCGCACGACCTGTTCGACAGT)
See all (5)
  1. 19jXyliOA86K9PDSjfSMEkbXGq8OGHsI82VxOLHoe95Si
  2. yMJ8aYThDsZYbO
Product

DNA nanotubes

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial