Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

double-strand DNA-grafted gold nanoparticles

Based on

1 Articles
2016 Most recent source

Composition

1

gold nanoparticles

Au nanoparticles Au particles Au-particles gold NP Au NP AuNP GNP
Type Nano Material
Formula
Role core
2

4,4'-(phenylphosphinidene)bis-benzenesulfonic acid dipotassium salt

bis(p-sulfonatophenyl) phenylphosphine dihydrate dipotassium salt bis(p-sulfonatophenyl)-phenylphosphine dihydrate dipotassium salt bis(p-sulfonatopheny) phenylphosphane dihydrate dipotassium salt bis(p-sulfonatophenyl)phenylphosphine dihydrate dipotassium salt bis(p-sulfonatophenyl)-phenylphosphine dihydrate dipotassium dipotassium bis(p-sulfonatophenyl)phenyl-phosphine dihydrate bis-p-sulfonatophenylphenyl phosphine dihydrate dipotassium potassium bis(p-sulfonatophenyl)-phenylphosphine dihydrate bis-p-sulfonatophenylphosphene dihydrate dipotassium salt bis-p-sulfonatophenylphosphine dihydrate dipotassium salt BSP phenylphosphine dihydrate dipotassium salt BSPP BPS SPP
Type Single Compound
Formula C18H17K2O8PS2
Role layer
3

[5'-desthiobiotin-d(GAGCATACATAGGGTTTCTCTTGGTTTCTT)-3']*[5'-d(AAGAAACCAAGAGAAACCCTATGTATGCTC)-SH-3']

Type Biomolecule
Formula
Role graft

Properties

Applications

Characterization

Biological effects

Preparation

Method 1

Type: Physical formation
Source:
  1. IxvMDKgt
  2. XDaMSz
  3. cOktcvJ0eoA242sx258H7I
Product

double-strand DNA-grafted gold nanoparticles

Method 2

Type: Physical formation
Source:
  1. J2cEO63Z
  2. dyCtvA
  3. dfqhQzst13a4eZRPIpEIQS
Product

double-strand DNA-grafted gold nanoparticles

Method 3

Type: Physical formation
Source:
  1. ZyM7SalZ
  2. AseNqM
  3. Mkv3dYeDn9SAetuHGQMV3Z
Product

double-strand DNA-grafted gold nanoparticles

Method 4

Type: Physical formation
Source:
  1. vOQos6DW
  2. bVPCUY
  3. JwU5jfFSim44ryqJwjfrg3
Product

double-strand DNA-grafted gold nanoparticles

Method 5

Type: Physical formation
Source:
  1. gyMhNJRI
  2. mN1h0e
  3. 5LtRxUegjX92y3P4DJ35QQ
Product

double-strand DNA-grafted gold nanoparticles

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial