Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

tether-containing DNA origami

Based on

1 Articles
2016 Most recent source

Composition

Image only illustrates the order and placement of components as described in literature.

1

DNA origami

Type Nano Material
Formula
Role raw materials
2

d(CTGCGCGTAACCACCACACCCGCCGC(T)68ACGAATATAGGGGCCTTGAATCGGCT)

Type Biomolecule
Formula
Role graft

Properties

Applications

Characterization

Biological effects

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • DNA scaffold
  • d(CTGCGCGTAACCACCACACCCGCCGC(T)68ACGAATATAGGGGCCTTGAATCGGCT)
  • staple DNA
  1. ET5uP6GYFCXgYBQrzlDCNvwkxUv7ii26FrnYmGWv4bInKp7BPHQd3yH
  2. 19Vt
Product

tether-containing DNA origami

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial