Loading ...

DNA hairpin-functionalized DNA nanocage

Based on

1 Articles
2016 Most recent source

Composition

1

d(TGGCTACAGTTTCGGTCAGCTTAGACATCGTTTGAATCCTATGCTCGGACGTTTGGCTCACAT)

d(TCACGGTCCTTTCTATCCGATCGAGGCATGTTTCATACTGAGAGCGTTCCGTTTGTCATGGAA)
Type Biomolecule
Formula
Role framework element
2

d(CAGATACGCTTTCATGCCTCGATCGGATAGTTTCTGTAGCCAATGTGAGCCTTTGTCGCAGTT)

d(TCACGGTCCTTTCTATCCGATCGAGGCATGTTTCATACTGAGAGCGTTCCGTTTGTCATGGAA)
Type Biomolecule
Formula
Role framework element
3

d(CTCAGTATGTTTCGGTTACGGTACAATGCCTTTCGCAAGACGTTAGTGTCCTTTCGGAACGCT)

d(CAGATACGCTTTCATGCCTCGATCGGATAGTTTCTGTAGCCAATGTGAGCCTTTGTCGCAGTT)
Type Biomolecule
Formula
Role framework element
4

d(CTCAGTATGTTTCGGTTACGGTACAATGCCTTTCGCAAGACGTTAGTGTCCTTTCGGAACGCT)

d(GGTGTATCGTTTGGCATTGTACCGTAACCGTTTGCGTATCTGAACTGCGACTTTCCACCGAAT)
Type Biomolecule
Formula
Role framework element
5

d(GGTGTATCGTTTGGCATTGTACCGTAACCGTTTGCGTATCTGAACTGCGACTTTCCACCGAAT)

d(CGTCTTGCGTTTGTATGACGCAGCACTTGCTTTCCTGGTGGCAACTCTAAGTTTGGACACTAA)
Type Biomolecule
Formula
Role framework element
6

d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)

d(CGTCTTGCGTTTGTATGACGCAGCACTTGCTTTCCTGGTGGCAACTCTAAGTTTGGACACTAA)
Type Biomolecule
Formula
Role framework element
7

d(GCCACCAGGTTTCGATGTCTAAGCTGACCGTCGAATATTTATCCCCCCCCATAAATATTCCTGGACCGTGATTCCATGACTTTCTTAGAGTT)

d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)
Type Biomolecule
Formula
Role framework element
8

d(TGGCTACAGTCGAATATTTATCCCCCCCCATAAATATTCCTCGGTCAGCTTAGACATCGTTTGAATCCTATGCTCGGACGTTTGGCTCACAT)

d(GCCACCAGGTTTCGATGTCTAAGCTGACCGTTTGGACCGTGATTCCATGACTTTCTTAGAGTT)
Type Biomolecule
Formula
Role framework element

Properties

General physical and chemical properties

Property Value Nanomaterial Variant Source
horseradish peroxidase (HRP) entrapment

More information available to subscribers only.

Or, view sample content

Applications

Characterization

Method Nanomaterial Variant Source
chromatography

More information available to subscribers only.

Or, view sample content

Biological effects

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)
  • d(TGGCTACAGTTTCGGTCAGCTTAGACATCGTTTGAATCCTATGCTCGGACGTTTGGCTCACAT)
  • d(GCCACCAGGTTTCGATGTCTAAGCTGACCGTTTGGACCGTGATTCCATGACTTTCTTAGAGTT)
See all (8)
  1. ESNivxx3SE95xu0aA6ub0r3zFYWQ9SU8fi6KNNaGQXX17wDAKldXpk2IH26
  2. v8T
  3. bd1NxN04FwXnzHvk5lkgwazz
Product

DNA hairpin-functionalized DNA nanocage

Size: not specified

Medium/Support: none

Method 2

Type: Chemical synthesis
Source:
Starting materials
  • d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)
  • d(GCCACCAGGTTTCGATGTCTAAGCTGACCGTCGAATATTTATCCCCCCCCATAAATATTCCTGGACCGTGATTCCATGACTTTCTTAGAGTT)
  • d(TCACGGTCCTCGAATATTTATCCCCCCCCATAAATATTCCTCTATCCGATCGAGGCATGTTTCATACTGAGAGCGTTCCGTTTGTCATGGAA)
See all (8)
  1. ytMrcHGYHTwSaZNRYXD6hMqw6eCyX1oDkotRJlXhah4pt1Gp9fG234ph4w6
  2. Ljl
  3. jbwE16oalDgiIuWqKrXr9VcB
Product

DNA hairpin-functionalized DNA nanocage

Size: not specified

Medium/Support: none

Method 3

Type: Chemical synthesis
Source:
Starting materials
  • d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)
  • d(CAGATACGCTTTCATGCCTCGATCGGATAGTCGAATATTTATCCCCCCCCATAAATATTCCTCTGTAGCCAATGTGAGCCTTTGTCGCAGTT)
  • d(TGGCTACAGTTTCGGTCAGCTTAGACATCGTTTGAATCCTATGCTCGGACGTTTGGCTCACAT)
See all (8)
  1. eTphJs8ajusZ2a2CjbIqMXyIM0wtM1yfD94DUqg42c8VE96deoKNm6Zgnb6
  2. oFg
  3. Wg2dP2SZHc966vLL5kvPzXXz
Product

DNA hairpin-functionalized DNA nanocage

Size: not specified

Medium/Support: none

Method 4

Type: Chemical synthesis
Source:
Starting materials
  • d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)
  • d(GCCACCAGGTTTCGATGTCTAAGCTGACCGTCGAATATTTATCCCCCCCCATAAATATTCCTGGACCGTGATTCCATGACTTTCTTAGAGTT)
  • d(GGTGTATCGTTTGGCATTGTACCGTAACCGTTTGCGTATCTGAACTGCGACTTTCCACCGAAT)
See all (8)
  1. mXyBPosyukkgCrZHOBqqAtZCGYNJ8bB8a1RrNfTUSAhS24nrn8UqYgxPlja
  2. HE2
  3. 21CZ8Un0nWBXhQiZkmorgnxa
Product

DNA hairpin-functionalized DNA nanocage

Size: not specified

Medium/Support: none

Method 5

Type: Chemical synthesis
Source:
Starting materials
  • d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)
  • d(TGGCTACAGTTTCGGTCAGCTTAGACATCGTTTGAATCCTATGCTCGGACGTTTGGCTCACAT)
  • d(GCCACCAGGTTTCGATGTCTAAGCTGACCGTCGAATATTTATCCCCCCCCATAAATATTCCTGGACCGTGATTCCATGACTTTCTTAGAGTT)
See all (8)
  1. Jmzkj3H0QmhJejNK9dd9ZcownwBWtl5tyaVjhEbMKd9FQfhb9znmMRHvePu
  2. EUa
  3. UeUJLZYmWeeXZ3narhNXPkxm
Product

DNA hairpin-functionalized DNA nanocage

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial