Loading ...

Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

DNA hairpin-functionalized DNA nanocage

Based on

1 Articles
2016 Most recent source

Composition

1

d(CAGATACGCTTTCATGCCTCGATCGGATAGTTTCTGTAGCCAATGTGAGCCTTTGTCGCAGTT)

Type Biomolecule
Formula
Role framework element
2

d(CTCAGTATGTTTCGGTTACGGTACAATGCCTTTCGCAAGACGTTAGTGTCCTTTCGGAACGCT)

Type Biomolecule
Formula
Role framework element
3

d(GGTGTATCGTTTGGCATTGTACCGTAACCGTTTGCGTATCTGAACTGCGACTTTCCACCGAAT)

Type Biomolecule
Formula
Role framework element
4

d(CGTCTTGCGTTTGTATGACGCAGCACTTGCTTTCCTGGTGGCAACTCTAAGTTTGGACACTAA)

Type Biomolecule
Formula
Role framework element
5

d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)

Type Biomolecule
Formula
Role framework element
6

d(GCCACCAGGTTTCGATGTCTAAGCTGACCGTCGAATATTTATCCCCCCCCATAAATATTCCTGGACCGTGATTCCATGACTTTCTTAGAGTT)

Type Biomolecule
Formula
Role framework element
7

d(TGGCTACAGTCGAATATTTATCCCCCCCCATAAATATTCCTCGGTCAGCTTAGACATCGTTTGAATCCTATGCTCGGACGTTTGGCTCACAT)

Type Biomolecule
Formula
Role framework element
8

d(TCACGGTCCTCGAATATTTATCCCCCCCCATAAATATTCCTCTATCCGATCGAGGCATGTTTCATACTGAGAGCGTTCCGTTTGTCATGGAA)

Type Biomolecule
Formula
Role framework element

Properties

General physical and chemical properties

Property Value Nanomaterial Variant Source
horseradish peroxidase (HRP) entrapment

More information available to subscribers only.

Or, view sample content

Applications

Characterization

Method Nanomaterial Variant Source
chromatography

More information available to subscribers only.

Or, view sample content

Biological effects

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)
  • d(GCCACCAGGTTTCGATGTCTAAGCTGACCGTCGAATATTTATCCCCCCCCATAAATATTCCTGGACCGTGATTCCATGACTTTCTTAGAGTT)
  • d(GGTGTATCGTTTGGCATTGTACCGTAACCGTTTGCGTATCTGAACTGCGACTTTCCACCGAAT)
See all (8)
  1. YIjpp5037ZigfcGamG4pwUSsj0rFyl7owwJNx758Ulw9PNFwkVwcZCmTLSk
  2. jsf
  3. qZjk6Q0G9z2CY49jKBjCBwr5
Product

DNA hairpin-functionalized DNA nanocage

Size: not specified

Medium/Support: none

Method 2

Type: Chemical synthesis
Source:
Starting materials
  • d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)
  • d(TGGCTACAGTTTCGGTCAGCTTAGACATCGTTTGAATCCTATGCTCGGACGTTTGGCTCACAT)
  • d(GCCACCAGGTTTCGATGTCTAAGCTGACCGTTTGGACCGTGATTCCATGACTTTCTTAGAGTT)
See all (8)
  1. m6ByJTcSHNZvwTvgwHUzFT6Tjofd2ImAqzGUrJPxC5wBMygkajoMCDG0ead
  2. gmj
  3. Q320yqA5O65gHr5qcbXdg30P
Product

DNA hairpin-functionalized DNA nanocage

Size: not specified

Medium/Support: none

Method 3

Type: Chemical synthesis
Source:
Starting materials
  • d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)
  • d(CAGATACGCTTTCATGCCTCGATCGGATAGTCGAATATTTATCCCCCCCCATAAATATTCCTCTGTAGCCAATGTGAGCCTTTGTCGCAGTT)
  • d(TGGCTACAGTTTCGGTCAGCTTAGACATCGTTTGAATCCTATGCTCGGACGTTTGGCTCACAT)
See all (8)
  1. uTzBLSBv8oxw5A9OjQMCdK0dYErJwcsbya0XXHUWLu9K9Q608o7v4Ooi2eF
  2. weX
  3. 6iVOOAE8U1k5Bcu2PofL5eoB
Product

DNA hairpin-functionalized DNA nanocage

Size: not specified

Medium/Support: none

Method 4

Type: Chemical synthesis
Source:
Starting materials
  • d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)
  • d(GCCACCAGGTTTCGATGTCTAAGCTGACCGTCGAATATTTATCCCCCCCCATAAATATTCCTGGACCGTGATTCCATGACTTTCTTAGAGTT)
  • d(TCACGGTCCTCGAATATTTATCCCCCCCCATAAATATTCCTCTATCCGATCGAGGCATGTTTCATACTGAGAGCGTTCCGTTTGTCATGGAA)
See all (8)
  1. HTJQ5k7L9l8JB5uncpjaQyTkuJxQA3jJU1ajR5LJTane2DaCl2z1yLrMfVW
  2. 2uw
  3. t2GZlOLwiZGrKTCYiXBTFrbE
Product

DNA hairpin-functionalized DNA nanocage

Size: not specified

Medium/Support: none

Method 5

Type: Chemical synthesis
Source:
Starting materials
  • d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)
  • d(TGGCTACAGTTTCGGTCAGCTTAGACATCGTTTGAATCCTATGCTCGGACGTTTGGCTCACAT)
  • d(GCCACCAGGTTTCGATGTCTAAGCTGACCGTCGAATATTTATCCCCCCCCATAAATATTCCTGGACCGTGATTCCATGACTTTCTTAGAGTT)
See all (8)
  1. E3PVmCz7H6mRhUUk3QtZZzIUCuHzRSGjLCcdybNmiJRuxEaHc9FZeOLgt6E
  2. UkP
  3. bC9xlyvYPHfnfQj78hnMsZe6
Product

DNA hairpin-functionalized DNA nanocage

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial