Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

DNA hairpin-functionalized DNA nanocage

Based on

1 Articles
2016 Most recent source

Composition

1

d(TGGCTACAGTTTCGGTCAGCTTAGACATCGTTTGAATCCTATGCTCGGACGTTTGGCTCACAT)

Type Biomolecule
Formula
Role framework element
2

d(TCACGGTCCTTTCTATCCGATCGAGGCATGTTTCATACTGAGAGCGTTCCGTTTGTCATGGAA)

Type Biomolecule
Formula
Role framework element
3

d(CTCAGTATGTTTCGGTTACGGTACAATGCCTTTCGCAAGACGTTAGTGTCCTTTCGGAACGCT)

Type Biomolecule
Formula
Role framework element
4

d(GGTGTATCGTTTGGCATTGTACCGTAACCGTTTGCGTATCTGAACTGCGACTTTCCACCGAAT)

Type Biomolecule
Formula
Role framework element
5

d(CGTCTTGCGTTTGTATGACGCAGCACTTGCTTTCCTGGTGGCAACTCTAAGTTTGGACACTAA)

Type Biomolecule
Formula
Role framework element
6

d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)

Type Biomolecule
Formula
Role framework element
7

d(GCCACCAGGTTTCGATGTCTAAGCTGACCGTCGAATATTTATCCCCCCCCATAAATATTCCTGGACCGTGATTCCATGACTTTCTTAGAGTT)

Type Biomolecule
Formula
Role framework element
8

d(CAGATACGCTTTCATGCCTCGATCGGATAGTCGAATATTTATCCCCCCCCATAAATATTCCTCTGTAGCCAATGTGAGCCTTTGTCGCAGTT)

Type Biomolecule
Formula
Role framework element

Properties

General physical and chemical properties

Property Value Source

Full content is available to subscribers only

To view content please choose from the following:

Applications

Characterization

Method Source

Full content is available to subscribers only

To view content please choose from the following:

Biological effects

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • d(ATAGGATTCTTTGCAAGTGCTGCGTCATACTTTCGATACACCATTCGGTGGTTTCGTCCGAGC)
  • d(CAGATACGCTTTCATGCCTCGATCGGATAGTCGAATATTTATCCCCCCCCATAAATATTCCTCTGTAGCCAATGTGAGCCTTTGTCGCAGTT)
  • d(TGGCTACAGTTTCGGTCAGCTTAGACATCGTTTGAATCCTATGCTCGGACGTTTGGCTCACAT)
See all (8)
  1. 5wXilv1sRDDEe2QoOuYq8mcyrIZM6F5srSq3rXl1XP08XePUIOz5HACwOhR
  2. 1TL
  3. vUtLMYLoLA1DPJOiOFkA5N3s
Product

DNA hairpin-functionalized DNA nanocage

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial