Loading ...

Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

gold nanoparticle-DNA conjugates

Based on

1 Articles
2016 Most recent source

Composition

Image only illustrates the order and placement of components as described in literature.

1

gold

Type Single Compound
Formula Au
Role core
2

d(GTAGAGACTCAAGTGATGGATTTTTT)-HS

Type Biomolecule
Formula
Role layer

Properties

Applications

Characterization

Biological effects

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  1. xQ76a6zRdyL71Y
Product

gold nanoparticle-DNA conjugates

Diameter: 10 nm

Medium/Support: none

Method 2

Type: Physical formation
Source:
Starting materials
  1. jKNqPgdsAq1zaZ
Product

gold nanoparticle-DNA conjugates

Diameter: 15 nm

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial