Loading ...

Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

DNA origami

Based on

18 Articles
2017 Most recent source

Composition

1

M13mp18 deoxyribonucleic acid

M13mp18 viral DNA
Type Biomolecule
Formula
Role framework element
2

deoxyribonucleic acid capture strands

DNA capture strands
Type Biomolecule
Formula
Role framework element
3

dye-labeled DNA strand

Type Biomolecule
Formula
Role framework element
4

biotin-labeled DNA strand

Type Biomolecule
Formula
Role framework element

Properties

General physical and chemical properties

Property Value Nanomaterial Variant Source
binding ability to biomimetic lipid patches

More information/entries available to subscribers only.

Or, view sample content

Applications

Area Application Nanomaterial Variant Source
analysis methods

More information/entries available to subscribers only.

Or, view sample content

Characterization

Method Nanomaterial Variant Source
atomic force microscopy

More information/entries available to subscribers only.

Or, view sample content

Biological effects

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • QD capture strand
  • single-stranded DNA scaffold
  • NP capture strand
See all (4)
  1. 1FjMeSGBXVkJZ1Qn7p92sOptRdrM
  2. MSCV8
Product

DNA origami

Outer edge: ~ 115 nm

Medium/Support: none

Method 2

Type: Chemical synthesis
Source:
Starting materials
  1. Ua1fnuSEebJlNYh4aeLsZjEaU7RyuSfjph
Product

DNA origami

Length: 80 nm

Spacing between AF647: ~ 11 - ~ 12 nm

Width: 60 nm

Medium: none

Support: Au nanorods/streptavidin-modified glass

Method 3

Type: Chemical synthesis
Source:
Starting materials
  • Alexa Fluor 568-modified DNA
  • DNA
  • Atto 647N-modified DNA
See all (4)
  1. eopDx3KcW7aOO9EYxEggCDPhFi1B0yH
  2. uHP9faypaou
  3. EMSdSADkgfxx8MlWIJUt4i3AdFLUnJq
  4. zUKs3EePCce3NvpSN
Product

DNA origami

Distance between donor and acceptor dyes: 6.0 - 9.4 nm

Length: 100 nm

Thickness: ~ 2 nm

Width: 70 nm

Medium/Support: none

Method 4

Type: Physical formation
Source:
Starting materials
  • 5'-d(GCGGTTGTCCAACTTACCAGATCCACAAGCCGACGTTACAGGATTGCC)-3'
  • 5'-d(CATACGCGAACGGTGTAGAGCACTAG)-3'
  • 5'-d(GTATGGGCAATCCACAACCGCAGTGA)-3'
See all (4)
  1. Wmrw4kZcmEBhkoLTSQrqjrqCJNBS8lOQE2i2NXZLP9LBchz5rmVe9usPJK
  2. EfhN
Product

DNA origami

Size: not specified

Medium/Support: none

Method 5

Type: Physical formation
Source:
Starting materials
  • 5'-d(CATTCTGGACGCCATAAGATAGCACCTCGACTCATTTGCCTGCGGTAG)-3'
  • 5'-d(CATACCGATCCGTGGCTACTGTCACT)-3'
  • 5'-d(CAGTAGCCTGCTATCTTATGGCGTGGCAAATGAGTCGAGGACGGATCG)-3'
See all (4)
  1. iuHkdnde5VnkmkTOR9RrIz4GB84NE16miCsAsHH9KD4GBGxU2H1hzTVIx2
  2. L7ZL
Product

DNA origami

Length: 12.5 nm

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial