Loading ...

Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

{GAGCGTTAGCCACACACACAGTC}*{cy3-TTAGGCGAGTGTGGCAGAGGTGT}*{CGCCTAAACAAGTGGAGACTGTG}*{cy5-AACGCTCACCACTTGAACACCTC} DNA tetrahedrons

Based on

1 Articles
2015 Most recent source

Composition

1

GAGCGTTAGCCACACACACAGTC ssDNA

Type Biomolecule
Formula
Role raw materials
2

Cy3 dye-labeled TTAGGCGAGTGTGGCAGAGGTGT ssDNA

Type Biomolecule
Formula
Role raw materials
3

CGCCTAAACAAGTGGAGACTGTG ssDNA

Type Biomolecule
Formula
Role raw materials
4

Cy5 dye-labeled AACGCTCACCACTTGAACACCTC ssDNA

Type Biomolecule
Formula
Role raw materials

Properties

Applications

Characterization

Method Nanomaterial Variant Source
fluorescence spectroscopy

More information available to subscribers only.

Or, view sample content

Biological effects

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • Cy3 dye-labeled TTAGGCGAGTGTGGCAGAGGTGT ssDNA
  • CGCCTAAACAAGTGGAGACTGTG ssDNA
  • Cy5 dye-labeled AACGCTCACCACTTGAACACCTC ssDNA
See all (4)
  1. QxEJIf745FnZLpdZxjltOLe0bKlQ
  2. a8nRtA
  3. si1Yz
  4. glssKp
Product

{GAGCGTTAGCCACACACACAGTC}*{cy3-TTAGGCGAGTGTGGCAGAGGTGT}*{CGCCTAAACAAGTGGAGACTGTG}*{cy5-AACGCTCACCACTTGAACACCTC} DNA tetrahedrons

Edge length: 2.4 nm

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial