Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

{SH-CCCTGTACTGGCTAGGAATTCACGTTTTAATCTGGGCTTTGGGTTAAGAAACTCCCCG}*{CGCTGGAGGCGCATCACCGTTTGCGTATGTGTTCTGTGCGGCCTGCCGTCCCGTGTGGG}*{SH-CGGTGATGCGCCTCCAGCGCGGGGAGTTTCTTAACCCTTTCCGACTTACAAGAGCCGG}*{GCGAGACTCAGGTGGTGCCTTTGGCATTCGACCAGGAGATATCGCGTTCAGCTATGCCC}*{SH-CCCATGAGAATAATACCGCCGATTTACGTCAGTCCGGTTTCCCACACGGGACGGCAGGC}*{CGCACAGAACACATACGCTTTGGGCATAGCTGAACGCGATATCTCCTGGTCGAATGCC}*{CATCTTGCCTAAAAAAAAAAGCCCAGATTAAAACGTGAATTCCTAGCCAGTACAGGGTTTCCGGACTGACGTAAATCGG}*{CGGTATTATTCTCATGGGTTTGGCACCACCTGAGTCTCGCCCGGCTCTTGTAAGTCGG} DNA tetrahedrons immobilized on gold

Based on

1 Articles
2015 Most recent source

Composition

1

SH-CCCTGTACTGGCTAGGAATTCACGTTTTAATCTGGGCTTTGGGTTAAGAAACTCCCCG ssDNA

Type Biomolecule
Formula
Role raw materials
2

SH-CGGTGATGCGCCTCCAGCGCGGGGAGTTTCTTAACCCTTTCCGACTTACAAGAGCCGG ssDNA

Type Biomolecule
Formula
Role raw materials
3

SH-CCCATGAGAATAATACCGCCGATTTACGTCAGTCCGGTTTCCCACACGGGACGGCAGGC ssDNA

Type Biomolecule
Formula
Role raw materials
4

CATCTTGCCTAAAAAAAAAAGCCCAGATTAAAACGTGAATTCCTAGCCAGTACAGGGTTTCCGGACTGACGTAAATCGG ssDNA

Type Biomolecule
Formula
Role raw materials
5

CGCTGGAGGCGCATCACCGTTTGCGTATGTGTTCTGTGCGGCCTGCCGTCCCGTGTGGG ssDNA

Type Biomolecule
Formula
Role raw materials
6

CGCACAGAACACATACGCTTTGGGCATAGCTGAACGCGATATCTCCTGGTCGAATGCC ssDNA

Type Biomolecule
Formula
Role raw materials
7

CGGTATTATTCTCATGGGTTTGGCACCACCTGAGTCTCGCCCGGCTCTTGTAAGTCGG ssDNA

Type Biomolecule
Formula
Role raw materials
8

GCGAGACTCAGGTGGTGCCTTTGGCATTCGACCAGGAGATATCGCGTTCAGCTATGCCC ssDNA

Type Biomolecule
Formula
Role raw materials

Properties

General physical and chemical properties

Property Value Source
cyclic voltammogram dependent on target DNA concentration

0 more entry available to subscribers only.

Or, view sample content

Sensor properties

Type of sensor Sensor property Source
compounds sensor for target DNA in aqueous solution

0 more entry available to subscribers only.

Or, view sample content

Applications

Area Application Source
diagnostics

0 more entry available to subscribers only.

Or, view sample content

Characterization

Method Source
atomic force microscopy

0 more entry available to subscribers only.

Or, view sample content

Biological effects

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • CGCACAGAACACATACGCTTTGGGCATAGCTGAACGCGATATCTCCTGGTCGAATGCC ssDNA
  • SH-CGGTGATGCGCCTCCAGCGCGGGGAGTTTCTTAACCCTTTCCGACTTACAAGAGCCGG ssDNA
  • CGGTATTATTCTCATGGGTTTGGCACCACCTGAGTCTCGCCCGGCTCTTGTAAGTCGG ssDNA
See all (8)
  1. ATkXFS7OSYzqkcapcHnx3EaXDfOy
  2. KSael0
  3. R9pLM
Product

{SH-CCCTGTACTGGCTAGGAATTCACGTTTTAATCTGGGCTTTGGGTTAAGAAACTCCCCG}*{CGCTGGAGGCGCATCACCGTTTGCGTATGTGTTCTGTGCGGCCTGCCGTCCCGTGTGGG}*{SH-CGGTGATGCGCCTCCAGCGCGGGGAGTTTCTTAACCCTTTCCGACTTACAAGAGCCGG}*{GCGAGACTCAGGTGGTGCCTTTGGCATTCGACCAGGAGATATCGCGTTCAGCTATGCCC}*{SH-CCCATGAGAATAATACCGCCGATTTACGTCAGTCCGGTTTCCCACACGGGACGGCAGGC}*{CGCACAGAACACATACGCTTTGGGCATAGCTGAACGCGATATCTCCTGGTCGAATGCC}*{CATCTTGCCTAAAAAAAAAAGCCCAGATTAAAACGTGAATTCCTAGCCAGTACAGGGTTTCCGGACTGACGTAAATCGG}*{CGGTATTATTCTCATGGGTTTGGCACCACCTGAGTCTCGCCCGGCTCTTGTAAGTCGG} DNA tetrahedrons immobilized on gold

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial