Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

{SH-CCCTGTACTGGCTAGGAATTCACGTTTTAATCTGGGCTTTGGGTTAAGAAACTCCCCG}*{CGCTGGAGGCGCATCACCGTTTGCGTATGTGTTCTGTGCGGCCTGCCGTCCCGTGTGGG}*{SH-CGGTGATGCGCCTCCAGCGCGGGGAGTTTCTTAACCCTTTCCGACTTACAAGAGCCGG}*{GCGAGACTCAGGTGGTGCCTTTGGCATTCGACCAGGAGATATCGCGTTCAGCTATGCCC}*{SH-CCCATGAGAATAATACCGCCGATTTACGTCAGTCCGGTTTCCCACACGGGACGGCAGGC}*{CGCACAGAACACATACGCTTTGGGCATAGCTGAACGCGATATCTCCTGGTCGAATGCC}*{CATCTTGCCTAAAAAAAAAAGCCCAGATTAAAACGTGAATTCCTAGCCAGTACAGGGTTTCCGGACTGACGTAAATCGG}*{CGGTATTATTCTCATGGGTTTGGCACCACCTGAGTCTCGCCCGGCTCTTGTAAGTCGG} DNA tetrahedrons immobilized on gold

Based on

1 Articles
2015 Most recent source

Composition

1

SH-CCCTGTACTGGCTAGGAATTCACGTTTTAATCTGGGCTTTGGGTTAAGAAACTCCCCG ssDNA

Type Biomolecule
Formula
Role raw materials
2

SH-CGGTGATGCGCCTCCAGCGCGGGGAGTTTCTTAACCCTTTCCGACTTACAAGAGCCGG ssDNA

Type Biomolecule
Formula
Role raw materials
3

SH-CCCATGAGAATAATACCGCCGATTTACGTCAGTCCGGTTTCCCACACGGGACGGCAGGC ssDNA

Type Biomolecule
Formula
Role raw materials
4

CATCTTGCCTAAAAAAAAAAGCCCAGATTAAAACGTGAATTCCTAGCCAGTACAGGGTTTCCGGACTGACGTAAATCGG ssDNA

Type Biomolecule
Formula
Role raw materials
5

CGCTGGAGGCGCATCACCGTTTGCGTATGTGTTCTGTGCGGCCTGCCGTCCCGTGTGGG ssDNA

Type Biomolecule
Formula
Role raw materials
6

CGCACAGAACACATACGCTTTGGGCATAGCTGAACGCGATATCTCCTGGTCGAATGCC ssDNA

Type Biomolecule
Formula
Role raw materials
7

CGGTATTATTCTCATGGGTTTGGCACCACCTGAGTCTCGCCCGGCTCTTGTAAGTCGG ssDNA

Type Biomolecule
Formula
Role raw materials
8

GCGAGACTCAGGTGGTGCCTTTGGCATTCGACCAGGAGATATCGCGTTCAGCTATGCCC ssDNA

Type Biomolecule
Formula
Role raw materials

Properties

General physical and chemical properties

Property Value Source

Full content is available to subscribers only

To view content please choose from the following:

Sensor properties

Type of sensor Sensor property Source

Full content is available to subscribers only

To view content please choose from the following:

Applications

Area Application Source

Full content is available to subscribers only

To view content please choose from the following:

Characterization

Method Source

Full content is available to subscribers only

To view content please choose from the following:

Biological effects

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • CGCACAGAACACATACGCTTTGGGCATAGCTGAACGCGATATCTCCTGGTCGAATGCC ssDNA
  • SH-CGGTGATGCGCCTCCAGCGCGGGGAGTTTCTTAACCCTTTCCGACTTACAAGAGCCGG ssDNA
  • CGGTATTATTCTCATGGGTTTGGCACCACCTGAGTCTCGCCCGGCTCTTGTAAGTCGG ssDNA
See all (8)
  1. uOwEEBnS58DJB6XLVUOxNPpCa4nR
  2. 94CZoj
  3. SYomw
Product

{SH-CCCTGTACTGGCTAGGAATTCACGTTTTAATCTGGGCTTTGGGTTAAGAAACTCCCCG}*{CGCTGGAGGCGCATCACCGTTTGCGTATGTGTTCTGTGCGGCCTGCCGTCCCGTGTGGG}*{SH-CGGTGATGCGCCTCCAGCGCGGGGAGTTTCTTAACCCTTTCCGACTTACAAGAGCCGG}*{GCGAGACTCAGGTGGTGCCTTTGGCATTCGACCAGGAGATATCGCGTTCAGCTATGCCC}*{SH-CCCATGAGAATAATACCGCCGATTTACGTCAGTCCGGTTTCCCACACGGGACGGCAGGC}*{CGCACAGAACACATACGCTTTGGGCATAGCTGAACGCGATATCTCCTGGTCGAATGCC}*{CATCTTGCCTAAAAAAAAAAGCCCAGATTAAAACGTGAATTCCTAGCCAGTACAGGGTTTCCGGACTGACGTAAATCGG}*{CGGTATTATTCTCATGGGTTTGGCACCACCTGAGTCTCGCCCGGCTCTTGTAAGTCGG} DNA tetrahedrons immobilized on gold

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial