Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

{ACACTACGTCAGAACAGCTTGCATCACTGGTCACCAGAGTA}*{cy3-ACGAGCGAGTTGATGTGATGCAAGCTGAATGCGAGGGTCCT}*{TCAACTCGCTCGTAACTACACTGTGCAATACTCTGGTGACC}*{cy5-TCTGACGTAGTGTATGCACAGTGTAGTAAGGACCCTCGCAT} DNA tetrahedrons

Based on

1 Articles
2015 Most recent source

Composition

1

ACACTACGTCAGAACAGCTTGCATCACTGGTCACCAGAGTA ssDNA

Type Biomolecule
Formula
Role raw materials
2

Cy3 dye-labeled ACGAGCGAGTTGATGTGATGCAAGCTGAATGCGAGGGTCCT ssDNA

Type Biomolecule
Formula
Role raw materials
3

TCAACTCGCTCGTAACTACACTGTGCAATACTCTGGTGACC ssDNA

Type Biomolecule
Formula
Role raw materials
4

Cy5 dye-labeled TCTGACGTAGTGTATGCACAGTGTAGTAAGGACCCTCGCAT ssDNA

Type Biomolecule
Formula
Role raw materials

Properties

Applications

Characterization

Method Source

Full content is available to subscribers only

To view content please choose from the following:

Biological effects

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • Cy5 dye-labeled TCTGACGTAGTGTATGCACAGTGTAGTAAGGACCCTCGCAT ssDNA
  • Cy3 dye-labeled ACGAGCGAGTTGATGTGATGCAAGCTGAATGCGAGGGTCCT ssDNA
  • ACACTACGTCAGAACAGCTTGCATCACTGGTCACCAGAGTA ssDNA
See all (4)
  1. wtUHvemc8BGn8klRwBJtcAjrxv5b
  2. Je4uYd
  3. c1W5M
  4. NPLnBu
Product

{ACACTACGTCAGAACAGCTTGCATCACTGGTCACCAGAGTA}*{cy3-ACGAGCGAGTTGATGTGATGCAAGCTGAATGCGAGGGTCCT}*{TCAACTCGCTCGTAACTACACTGTGCAATACTCTGGTGACC}*{cy5-TCTGACGTAGTGTATGCACAGTGTAGTAAGGACCCTCGCAT} DNA tetrahedrons

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial