Loading ...

fluorophore-labeled DNA origami

Based on

4 Articles
2017 Most recent source

Composition

1

DNA

Type Biomolecule
Formula
Role framework element
2

DNA

Type Biomolecule
Formula
Role framework element
3

DNA

Type Biomolecule
Formula
Role framework element
4

DNA

Type Biomolecule
Formula
Role framework element
5

DNA

Type Biomolecule
Formula
Role framework element
6

DNA

Type Biomolecule
Formula
Role framework element
7

Cy5-labeled single-stranded linking strand

SSLS-Cy5
Type Biomolecule
Formula
Role framework element
8

NTS peptide-functionalized RS strand

NTS-RS
Type Biomolecule
Formula
Role framework element

Properties

General physical and chemical properties

Property Value Nanomaterial Variant Source
donor excitation/direct excitation acceptor fluorescence ratio

More information/entries available to subscribers only.

Or, view sample content

Applications

Characterization

Method Nanomaterial Variant Source
atomic force microscopy

More information/entries available to subscribers only.

Or, view sample content

Biological effects

Biological system Test details Nanomaterial Variant Source
HEK 293 cells

More information/entries available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • 5'-tris(nitrilotriacetic acid)-modified 5'-d(TTTTTTTTGAGGCAATTCTGAAAATACGTAGAAGGCAC)-3'
  • 3'-amino-modified 5'-d(CATCGGAAAGTACCAGGCGGATTTTTTTTTT)-3'
  • 3'-amino-modified 5'-d(CAAAGACACAGAGCCATTTCATAATCAAAATCTTTTTTTTTTTTTT)-3'
See all (8)
  1. cIHbA2LaCeMq7GwjcQ0BgjCoCJgQkRWKzGrGYCy3lt
  2. IksFLa
Product

fluorophore-labeled DNA origami

Cavity depth: ~ 14 nm

Cavity length: ~ 14.5 nm

Cavity width: ~ 11 nm

Length: ~ 32 nm

Width: ~ 18 nm

Medium/Support: none

Method 2

Type: Physical formation
Source:
Starting materials
  • 3'-amino-modified 5'-d(TATTAATTGAGTAACAAAATCGCGCAGAGGCGTTTTTT)-3'
  • 3'-amino-modified 5'-d(GAGCCGCCGAGCCGCCTGGTTTACATTGACGGTTTTTT)-3'
  • 3'-amino-modified 5'-d(AATAAATCCTCATTAATTGATATTCGTAGAAAAGTTTATTTTTTTT)-3'
See all (8)
  1. BInD9rYEbfSvqoz98IIEzw88hmlWWY8rqxrfDpGDnY
  2. kHRWQ8
Product

fluorophore-labeled DNA origami

Cavity depth: 10 nm

Cavity length: 11 nm

Cavity width: 11 nm

Length: 35 nm

Width: ~ 20 nm

Medium/Support: none

Method 3

Type: Physical formation
Source:
Starting materials
  • 3'-amino-modified 5'-d(GCAATAATGTAAGCAGATAGCCGAACAAAGTTACCTTTTTT)-3'
  • 5'-tris(nitrilotriacetic acid)-modified 5'-d(TTTTTTTATTTTAAATGCTAATGTGTAGGTAAAGAGCATGTC)-3'
  • 3'-amino-modified 5'-d(GAAGCAAATATGCAACTAAAGTACGGTGTTTTTTT)-3'
See all (8)
  1. LlOuisuRgh6YbyiTh4ybdfBboJ20hZQfMicRKLGWub
  2. zxZtyR
Product

fluorophore-labeled DNA origami

Cavity length: 11 nm

Cavity width: 11 nm

Length: 83 nm

Thickness: 2 nm

Width: 72 nm

Medium/Support: none

Method 4

Type: Physical formation
Source:
Starting materials
  • DNA
  1. hxN6cpzaNcKyGWyokByBBHAapy47oQlaggDpSwR5qxo1Vby4HYQZFyDZMAzskeIT8sc
  2. uuECKOUSx75F82km07EaKbUE7iV8sezqz1
Product

fluorophore-labeled DNA origami

Size: not specified

Medium/Support: none

Method 5

Type: Physical formation
Source:
Starting materials
Product

fluorophore-labeled DNA origami

Hydrodynamic diameter: 6 - 25 nm

Medium: phosphate buffer solution

Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial