Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

mixed -S-PEG6:-SC6-ssDNA-10b functionalized gold nanoprisms

Based on

1 Articles
2015 Most recent source

Composition

1

gold

Type Single Compound
Formula Au
Role core
2

polyethylene glycol thiol/thiol-modified DNA

Type Complex Compound
Formula
Role layer

Properties

General physical and chemical properties

Property Value Source
surface plasmon resonance

0 more entry available to subscribers only.

Or, view sample content

Sensor properties

Type of sensor Sensor property Source
compounds sensor for miR-10b RNA

0 more entry available to subscribers only.

Or, view sample content

Applications

Area Application Source
diagnostics

0 more entry available to subscribers only.

Or, view sample content

Characterization

Method Source
UV

1 more entry available to subscribers only.

Or, view sample content

Biological effects

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • 5'-[HS(CH2)6]-d(CACAAATTCGGTTCTACAGGGTA)-3'
  • gold nanoprisms
  • polyethylene glycol thiol
  1. 2BvAmOX6TFeI
Product

mixed -S-PEG6:-SC6-ssDNA-10b functionalized gold nanoprisms

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial