Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

barcode-like nucleic acid nanostructure

Based on

1 Articles
2014 Most recent source

Composition

1

single-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
2

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
3

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
4

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
5

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
6

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
7

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
8

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
9

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
10

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
11

single-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element

Properties

Applications

Area Application Source
diagnostics

1 more entry available to subscribers only.

Or, view sample content

Characterization

Method Source
atomic force microscopy

0 more entry available to subscribers only.

Or, view sample content

Biological effects

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • CGCGGGCCGCCTTTCAATTAT single-stranded oligodeoxynucleotide
  • CGTGCGGTCCCTACGCGCAGT single-stranded oligodeoxynucleotide
  • CTTGCTTTGCCTCCTAACGATCTGGGCGGACGACTTAAGCGAAGCAAGGTAA single-stranded oligodeoxynucleotide
See all (61)
  1. OsoHt
  2. xiMbooY92
  3. ZJYphMtUrlP
  4. BugoZEPUwjFPoStLfeypuzBSB70FKq9vyX3Xcj
  5. 1cAkeeBjBEzSWQ8Wxet
  6. 30ja624PQc
  7. wTqXTf
  8. W8Cexx611NBXYMdclT5I3TIhiJz
  9. NvmX
Product

barcode-like nucleic acid nanostructure

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial