Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

barcode-like nucleic acid nanostructure

Based on

1 Articles
2014 Most recent source

Composition

1

single-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
2

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
3

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
4

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
5

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
6

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
7

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
8

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
9

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
10

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element
11

single-stranded oligodeoxynucleotide mixture

Type Complex Compound
Formula
Role framework element

Properties

Applications

Area Application Source

Full content is available to subscribers only

To view content please choose from the following:

Characterization

Method Source

Full content is available to subscribers only

To view content please choose from the following:

Biological effects

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • CGCGGGCCGCCTTTCAATTAT single-stranded oligodeoxynucleotide
  • CGTGCGGTCCCTACGCGCAGT single-stranded oligodeoxynucleotide
  • CTTGCTTTGCCTCCTAACGATCTGGGCGGACGACTTAAGCGAAGCAAGGTAA single-stranded oligodeoxynucleotide
See all (61)
  1. Appjb
  2. PKlX5yg2N
  3. kLQScwyg8Z8
  4. NjDvAIzM9bOzWDuMV4u33XHiBi95Odnyv20E1x
  5. WjDisEAz79kuxjqdzP3
  6. B31btfCYBa
  7. NRCTaX
  8. bvvmgghtzujkpxNlvUN4saH8nYZ
  9. X7Cu
Product

barcode-like nucleic acid nanostructure

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial