Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

barcode-like nucleic acid nanostructure

Based on

1 Articles
2014 Most recent source



single-stranded oligodeoxynucleotide mixture

Type Complex Compound
Role framework element

single-stranded oligodeoxynucleotide mixture

Type Complex Compound
Role framework element

single-stranded oligodeoxynucleotide mixture

Type Complex Compound
Role framework element

single-stranded oligodeoxynucleotide mixture

Type Complex Compound
Role framework element

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Role framework element

single-stranded oligodeoxynucleotide mixture

Type Complex Compound
Role framework element

partially double-stranded oligodeoxynucleotide mixture

Type Complex Compound
Role framework element

single-stranded oligodeoxynucleotide mixture

Type Complex Compound
Role framework element

single-stranded oligodeoxynucleotide mixture

Type Complex Compound
Role framework element

single-stranded oligodeoxynucleotide mixture

Type Complex Compound
Role framework element

single-stranded oligodeoxynucleotide mixture

Type Complex Compound
Role framework element



Area Application Source

More information available to subscribers only.

Or, view sample content


Method Source
atomic force microscopy

More information available to subscribers only.

Or, view sample content

Biological effects


Method 1

Type: Chemical synthesis
Starting materials
  • CGCGGGCCGCCTTTCAATTAT single-stranded oligodeoxynucleotide
See all (61)
  1. On07F
  2. LEPlG5Oae
  3. OdB7s01hoF1
  4. WbyN3awKNw2X35oCZ7AxLW7R3D4HEkhWiejpXx
  5. 9y4ABTHuPUxoVQFdZQs
  6. tNIEyUyf9g
  7. 2eJVg6
  8. y9uxNufutBzMkPGerYCYOf8oGG2
  9. dEH0

barcode-like nucleic acid nanostructure


Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial