Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

RNA-DNA hybrid origami barcode-like nanostructure

Based on

1 Articles
2014 Most recent source

Composition

1

single-stranded RNA scaffold

Type Biomolecule
Formula
Role raw materials
2

TTGGTAACTGTCAGACCACTGGATGGAGGCGGAT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
3

CCTCACTGATTAAGCA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
4

GATCGCTGAGATAGGTGTTCTGCGCTCGGCCCTT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
5

ATGAACGAAATAGACA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
6

GAGTCAGGCAACTATGGTTGCTGATAAATCTGGA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
7

TTATCTACACGACGGG single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
8

GCCCTCCCGTATCGTAGCTCGCGGT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
9

GAACTACTTACTCTAGCAGTAAGAGAATTATGCA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
10

{CAAACTATTAACTGGCCTGGGCGGACAAAGTTGCAGGACCAC}*{GTCCGCCCAG} partially double-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
11

ATGGCAACAACGTTGCGGAGTGATAACACTGCGG single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
12

{CACGATGCCTGTAGCACTGGGCGGACCCGGCTGGCTGGTTTA}*{GTCCGCCCAG} partially double-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
13

AACGACGAGCGTGACACAACGATCGGAGGACCGA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
14

{GAATGAAGCCATACCACTGGGCGGACGCCGGTGAGCGTGGGT}*{GTCCGCCCAG} partially double-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
15

{ATCATTGCACTGGGCGGACCGTTGGGAA}*{GTCCGCCCAG} partially double-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
16

CCGGAGCTTTTGCACA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
17

CACCAGTCACAGAAAGGAAACGCTGGTGAAAGT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
18

{GACTTGGTTGAGTACTCTGGGCGGACGTGCTGCCATAACCAT}*{GTCCGCCCAG} partially double-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
19

TACACTATTCTCAGAATCAGTTGGGTGCACGAGT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
20

{CAACTCGGTCGCCGCACTGGGCGGACCCAACTTACTTCTGAC}*{GTCCGCCCAG} partially double-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
21

TTGACGCCGGGCAAGAGGATCTCAACAGCGGTAA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
22

{GCGGTATTATCCCGTACTGGGCGGACAGGAGCTAACCGCTTT}*{GTCCGCCCAG} partially double-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
23

{ACATGGGGGCTGGGCGGACAAGTTCTGC}*{GTCCGCCCAG} partially double-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
24

TATGTGGCCGCCCCGA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
25

TTTTGCGGCATTTTGCCGAAAGGGCCTCGTGATA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
26

{TCGCCCTTATTCCCTTCTGGGCGGACAAAAGATGCTGAAGAT}*{GTCCGCCCAG} partially double-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
27

TATTCAACATTTCCGTGTTAATGTCATGATAATA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
28

{AAAGGAAGAGTATGAGCTGGGCGGACGGGTTACATCGAACTG}*{GTCCGCCCAG} partially double-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
29

GCTTCAATAATATTGAACAGGTGGCACTTTTCGG single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
30

{AATAACCCTGATAAATCTGGGCGGACGATCCTTGAGAGTTTT}*{GTCCGCCCAG} partially double-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
31

{AGAACGTTTCTGGGCGGACGTATCCGCT}*{GTCCGCCCAG} partially double-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
32

CATGAGACCCCCTATTTGTTTATTT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
33

CGCCTATTTTTATAGG single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
34

ATGGTTTCTTAGACGT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
35

GGAAATGTGCGCGGAA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element

Properties

Applications

Area Application Source
medicine/veterinary

0 more entry available to subscribers only.

Or, view sample content

Characterization

Method Source
atomic force microscopy

0 more entry available to subscribers only.

Or, view sample content

Biological effects

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • AAAGGAAGAGTATGAGCTGGGCGGACGGGTTACATCGAACTG single-stranded oligodeoxynucleotide
  • CGCCTATTTTTATAGG single-stranded oligodeoxynucleotide
  • TATTCAACATTTCCGTGTTAATGTCATGATAATA single-stranded oligodeoxynucleotide
See all (36)
  1. ZmMqe
  2. YW4xexqiF
  3. bEl4Pka3mLm
  4. BZEXRh64XykORuUi8cFBvETKpDtOHwhUfhSkLX
  5. mqarb6Gt7PVthK5Vj1q
  6. 87tOJS
  7. vN1KgQCKukao0pxXf8YfTpeII
  8. BwfeSV
Product

RNA-DNA hybrid origami barcode-like nanostructure

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial