Loading ...

Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

RNA-DNA hybrid origami barcode-like nanostructure

Based on

1 Articles
2014 Most recent source

Composition

1

single-stranded RNA scaffold

Type Biomolecule
Formula
Role raw materials
2

TTGGTAACTGTCAGACCACTGGATGGAGGCGGAT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
3

CCTCACTGATTAAGCA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
4

GATCGCTGAGATAGGTGTTCTGCGCTCGGCCCTT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
5

ATGAACGAAATAGACA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
6

GAGTCAGGCAACTATGGTTGCTGATAAATCTGGA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
7

TTATCTACACGACGGG single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
8

GCCCTCCCGTATCGTAGCTCGCGGT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
9

GAACTACTTACTCTAGCAGTAAGAGAATTATGCA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
10

CAAACTATTAACTGGCAAAGTTGCAGGACCAC single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
11

ATGGCAACAACGTTGCGGAGTGATAACACTGCGG single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
12

CACGATGCCTGTAGCACCGGCTGGCTGGTTTA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
13

AACGACGAGCGTGACACAACGATCGGAGGACCGA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
14

GAATGAAGCCATACCAGCCGGTGAGCGTGGGT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
15

ATCATTGCACGTTGGGAA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
16

CCGGAGCTTTTGCACA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
17

CACCAGTCACAGAAAGGAAACGCTGGTGAAAGT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
18

GACTTGGTTGAGTACTGTGCTGCCATAACCAT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
19

TACACTATTCTCAGAATCAGTTGGGTGCACGAGT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
20

CAACTCGGTCGCCGCACCAACTTACTTCTGAC single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
21

TTGACGCCGGGCAAGAGGATCTCAACAGCGGTAA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
22

GCGGTATTATCCCGTAAGGAGCTAACCGCTTT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
23

ACATGGGGGAAGTTCTGC single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
24

TATGTGGCCGCCCCGA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
25

TTTTGCGGCATTTTGCCGAAAGGGCCTCGTGATA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
26

TCGCCCTTATTCCCTTAAAAGATGCTGAAGAT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
27

TATTCAACATTTCCGTGTTAATGTCATGATAATA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
28

AAAGGAAGAGTATGAGGGGTTACATCGAACTG single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
29

GCTTCAATAATATTGAACAGGTGGCACTTTTCGG single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
30

AATAACCCTGATAAATGATCCTTGAGAGTTTT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
31

AGAACGTTTGTATCCGCT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
32

CATGAGACCCCCTATTTGTTTATTT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
33

CGCCTATTTTTATAGG single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
34

ATGGTTTCTTAGACGT single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element
35

GGAAATGTGCGCGGAA single-stranded oligodeoxynucleotide

Type Biomolecule
Formula
Role framework element

Properties

Applications

Area Application Nanomaterial Variant Source
medicine/veterinary

More information available to subscribers only.

Or, view sample content

Characterization

Method Nanomaterial Variant Source
atomic force microscopy

More information available to subscribers only.

Or, view sample content

Biological effects

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • AAAGGAAGAGTATGAGCTGGGCGGACGGGTTACATCGAACTG single-stranded oligodeoxynucleotide
  • CCGGAGCTCTGGGCGGACTTTGCACA single-stranded oligodeoxynucleotide
  • CGCCTATTTTTATAGG single-stranded oligodeoxynucleotide
See all (36)
  1. keRkv
  2. gFV8GbD3X
  3. O7OlripNlBp
  4. NfRsORQGwB30P5KZt1uQW05G2xUpdwDkpYu2dj
  5. FBJ1tAfFlecbFUg7Lm8
  6. mZvnzS
  7. 09pPJF0XGlae1PB5zOyRxOPng
  8. 0hHN6V
Product

RNA-DNA hybrid origami barcode-like nanostructure

Length: 33.3 - 36.5 nm

Width: 37.8 - 41.8 nm

Medium/Support: none

Method 2

Type: Chemical synthesis
Source:
Starting materials
  • ATCATTGCACGTTGGGAA single-stranded oligodeoxynucleotide
  • CGCCTATTTTTATAGG single-stranded oligodeoxynucleotide
  • TATTCAACATTTCCGTGTTAATGTCATGATAATA single-stranded oligodeoxynucleotide
See all (35)
  1. Gb2ds
  2. Nd8Hfpirm
  3. vnGtKK7ZskG
  4. MrDk4PD7ByK2cJyaxQ6IXslIMnesLanEclWXgU
  5. khbS3DGncGf6HamGBwS
  6. h3EJ54
  7. G7SPjxPEsDKjAcn2h6fRTNByI
  8. TStdep
Product

RNA-DNA hybrid origami barcode-like nanostructure

Length: 29.7 - 33.3 nm

Width: 18.4 - 21.2 nm

Medium/Support: none

Method 3

Type: Chemical synthesis
Source:
Starting materials
  • AAAGGAAGAGTATGAGCTGGGCGGACGGGTTACATCGAACTG single-stranded oligodeoxynucleotide
  • CGCCTATTTTTATAGG single-stranded oligodeoxynucleotide
  • TATTCAACATTTCCGTGTTAATGTCATGATAATA single-stranded oligodeoxynucleotide
See all (36)
  1. 7OrF0
  2. B3IZSwlbV
  3. W9yRrE7aQkV
  4. hHEcP1pj4n5UKcGl0CtLdUSS2XqJtl38pb9TaU
  5. zCyWqgp9UVMTVk2YjYa
  6. s8OZGl
  7. rWLdIBblCYTejLCgCHtIDzirU
  8. dZovUq
Product

RNA-DNA hybrid origami barcode-like nanostructure

Length: 34.4 - 38.2 nm

Width: 25.3 - 28.1 nm

Medium/Support: none

Method 4

Type: Chemical synthesis
Source:
Starting materials
  • ATCATTGCACGTTGGGAA single-stranded oligodeoxynucleotide
  • CGCCTATTTTTATAGG single-stranded oligodeoxynucleotide
  • TATTCAACATTTCCGTGTTAATGTCATGATAATA single-stranded oligodeoxynucleotide
See all (36)
  1. BqOIX
  2. l73m9Fvai
  3. aTa3bW2Uutl
  4. De9CrNLmBmLdY5ObKXKD5j8lWYIQ8edne4ZZrN
  5. l1HaBqdsQeYlzdGAvr9
  6. 1Aqj2O
  7. Jcj4UhDn3udrl8dpBahXVwYOS
  8. SGXmIx
Product

RNA-DNA hybrid origami barcode-like nanostructure

Length: 33.0 - 38.4 nm

Width: 24.4 - 28.6 nm

Medium/Support: none

Method 5

Type: Chemical synthesis
Source:
Starting materials
  • AAAGGAAGAGTATGAGCTGGGCGGACGGGTTACATCGAACTG single-stranded oligodeoxynucleotide
  • CGCCTATTTTTATAGG single-stranded oligodeoxynucleotide
  • TATTCAACATTTCCGTGTTAATGTCATGATAATA single-stranded oligodeoxynucleotide
See all (36)
  1. Eyyqa
  2. n66aTWkRw
  3. rQ3DGnz6eDt
  4. yB0r7jcXwXSS0mvUoI9gTCwms2Gawxix3xC08U
  5. mwrmZb3KHeNWxnPJUXR
  6. EmCzwz
  7. EdtU7Sxi5qiSBKtn2Xg1GPOBq
  8. 3BCcgP
Product

RNA-DNA hybrid origami barcode-like nanostructure

Length: 30.1 - 35.3 nm

Width: 27.1 - 31.9 nm

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial