Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

RNA-functionalized gold nanoparticles

Based on

1 Articles
2015 Most recent source

Composition

1

gold

Type Single Compound
Formula Au
Role core
2

[5'-r(AACAAUUAUACUCAGCAA)-3'-[(C2H4O)6PO3]2OC3H6SH]*[5'-r(UUGCUGAGUAUAAUUGUUAUUUCCUUU)-3']*[5'-r(AAAUCAGUGCUGCUCAGUAA)-3']

Type Biomolecule
Formula
Role layer

Properties

Applications

Characterization

Biological effects

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • 5'-r(AAAUCAGUGCUGCUCAGUAA)-3'
  • 5'-r(UUGCUGAGUAUAAUUGUUAUUUAGUCACGACGAGUCAUUAUUUCCUUU)-3'
  1. qvAmBjJAp8qA
Product

RNA-functionalized gold nanoparticles

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial