Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

DNA nanotubes

Based on

1 Articles
2015 Most recent source

Composition

Image only illustrates the order and placement of components as described in literature.

1

hybridized DNA oligonucleotide construct

Type Complex Compound
Formula
Role raw materials

Properties

General physical and chemical properties

Property Value Source
fluorescence melting curve

3 more entries available to subscribers only.

Or, view sample content

Applications

Characterization

Method Source
transmission electron microscopy

0 more entry available to subscribers only.

Or, view sample content

Biological effects

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • 5'-azido-3'-alkyne-modified 5'-d(TACGTAAGGTAAATACTCATCCCTGAGTGATCCATGACCCTT)-3'
  • 5'-azido-3'-alkyne-modified 5'-d(ATGCCAGGAAAGGCTGTAAGTTGCATCATGGGGGTCCTCAAT)-3'
  • 5'-azido-3'-alkyne-modified 5'-d(GGCATCGTTGGAGTCTGGCGCACGACTTCGATTTCGGATCCT)-3'
See all (24)
  1. kuFZhDim6Ynsfgnv
  2. fRlY
  3. d46seY8tgvYhcH8J
  4. iVuRn0B
Product

DNA nanotubes

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial