Loading ...

Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

methylene blue-labeled thiol-terminated DNA-gold nanoparticles conjugates

Based on

1 Articles
2014 Most recent source

Composition

Image only illustrates the order and placement of components as described in literature.

1

gold

Type Single Compound
Formula Au
Role core
2

methylene blue-labeled thiol-terminated DNA

Type Biomolecule
Formula
Role layer
3

methylene blue-labeled thiol-terminated DNA

Type Biomolecule
Formula
Role layer

Properties

Sensor properties

Type of sensor Sensor property Nanomaterial Variant Source
compounds sensor for GGTGGATAGCAGTACCTGAGCCATAATCAT DNA in PBS (pH 7.4) containing NaNO<sub>3</sub> solution in presence of Au-HS-TTTTTTTTTTATGATTATGGCTCAG (sandwich-type detection)

More information available to subscribers only.

Or, view sample content

Applications

Area Application Nanomaterial Variant Source
diagnostics

More information available to subscribers only.

Or, view sample content

Characterization

Biological effects

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  1. fYoEUV0W8tGpy1Hv
  2. CEij1Q
Product

methylene blue-labeled thiol-terminated DNA-gold nanoparticles conjugates

Diameter: 13 nm

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial