Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

methylene blue-labeled thiol-terminated DNA-gold nanoparticles conjugates

Based on

1 Articles
2014 Most recent source

Composition

Image only illustrates the order and placement of components as described in literature.

1

gold

Type Single Compound
Formula Au
Role core
2

methylene blue-labeled thiol-terminated DNA

Type Biomolecule
Formula
Role layer
3

methylene blue-labeled thiol-terminated DNA

Type Biomolecule
Formula
Role layer

Properties

Sensor properties

Type of sensor Sensor property Source
compounds sensor for GGTGGATAGCAGTACCTGAGCCATAATCAT DNA in PBS (pH 7.4) containing NaNO<sub>3</sub> solution in presence of Au-HS-TTTTTTTTTTATGATTATGGCTCAG (sandwich-type detection)

0 more entry available to subscribers only.

Or, view sample content

Applications

Area Application Source
diagnostics

0 more entry available to subscribers only.

Or, view sample content

Characterization

Biological effects

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  1. iRFfYy0sNL2M8RC2
  2. kxf0S4
Product

methylene blue-labeled thiol-terminated DNA-gold nanoparticles conjugates

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial