Loading ...

Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

Mu peptide-condensed, Dz-13/OGX-427-loaded, Cy5-dCTP-incorporated 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

Based on

1 Articles
2015 Most recent source

Composition

1

Dz-13/OGX-427-loaded 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

Type Nano Material
Formula
Role core
2

adenovirus core complex-derived Mu peptide

adenovirus-derived Mu peptide
Type Biomolecule
Formula
Role layer

Properties

General physical and chemical properties

Property Value Nanomaterial Variant Source
Zeta potential

More information available to subscribers only.

Or, view sample content

Applications

Characterization

Method Nanomaterial Variant Source
dynamic light scattering

More information/entries available to subscribers only.

Or, view sample content

Biological effects

Biological system Test details Nanomaterial Variant Source
human epidermal carcinoma KB cell tumor-bearing athymic nude mouse

More information/entries available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Physical formation
Source:
Product

Mu peptide-condensed, Dz-13/OGX-427-loaded, Cy5-dCTP-incorporated 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

Hydrodynamic diameter: 97.9 - 227.5 nm

Medium: water

Support: none

Method 2

Type: Chemical synthesis
Source:
Starting materials
  • 5'-TATATACTAGTCAGATATTACT-3' oligodeoxynucleotide
  1. VCgevClmCj3hXE2HCGmq5GOYw0cVYodtW6YlkQc1053fc9e98Gv59nUalXWcVUkQ0bIw7e8eHn4xQnuRxmEqjp0MWuaD1arYkg5x3hAMWOGAVLQf
  2. UGNnsD7PIZnFuM2sC6kCebYyi
  3. Pmjy1a
Product

Mu peptide-condensed, Dz-13/OGX-427-loaded, Cy5-dCTP-incorporated 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

Size: not specified

Medium/Support: none

Method 3

Type: Chemical synthesis
Source:
Starting materials
  • 5'-TATATACTAGTCAGATATTACT-3' oligodeoxynucleotide
  1. FYoVhEL6NwYLT5SBd2lJ0RmUuqSmhpvvRU6LWOb5DtW4OMrv152FEJZnfgeaK3w9J3RPFoiMFIgLpbzG41NHFp0f3rvuOLIMVnwWRPDNax33KImv
  2. Uf2N78eUYCRAqUBlIlAX51muM
  3. VL9sf0
Product

Mu peptide-condensed, Dz-13/OGX-427-loaded, Cy5-dCTP-incorporated 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial