Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

Mu peptide-condensed, Dz-13/OGX-427-loaded 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

Based on

1 Articles
2015 Most recent source

Composition

1

Dz-13/OGX-427-loaded 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

Type Nano Material
Formula
Role core
2

adenovirus core complex-derived Mu peptide

adenovirus-derived Mu peptide
Type Biomolecule
Formula
Role layer

Properties

Applications

Characterization

Method Source
scanning electron microscopy

More information available to subscribers only.

Or, view sample content

Biological effects

Biological system Test details Source
human epidermal carcinoma KB cell tumor-bearing athymic nude mouse

More information available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • 5'-TATATACTAGTCAGATATTACT-3' oligodeoxynucleotide
  1. hG01gSiZKT5Yaed48w4gSXailO1HdrjkKsHoJMRsiGQ4fWtA050szniq218Vi8obCBwTcDWrYtOlmclBvXvcav7qFHtnkTJAJq7Ldy0shHN85K4w
  2. klySrJRzIehyD6G8ErIyUww9w
  3. rKWMmL
Product

Mu peptide-condensed, Dz-13/OGX-427-loaded 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial