Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

Mu peptide-condensed, FAM-Dz-13/ROX-OGX-427-loaded 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

Based on

1 Articles
2015 Most recent source

Composition

1

FAM-Dz-13/ROX-OGX-427-loaded 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

Type Nano Material
Formula
Role core
2

adenovirus core complex-derived Mu peptide

adenovirus-derived Mu peptide
Type Biomolecule
Formula
Role layer

Properties

Applications

Characterization

Biological effects

Biological system Test details Source
human epidermal carcinoma KB cells

0 more entry available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • 5'-TATATACTAGTCAGATATTACT-3' oligodeoxynucleotide
  1. rsWayyL5TAacLN1coEVYmxR2wZaRt1pkYV5BKpflayTliYGFiyr1axuGDy945VnkS24SGL6hR7yIrLVZhX5vIEmIRM6dhivmUUtBZwaoJgDkLcBh
  2. wd5PC2klI4EL1lOTQyB2cGs2x
  3. WmCLcg
Product

Mu peptide-condensed, FAM-Dz-13/ROX-OGX-427-loaded 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial