Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

hyaluronic acid-coated, Mu peptide-condensed, Dz-13/OGX-427-loaded 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

Based on

1 Articles
2015 Most recent source

Composition

1

Dz-13/OGX-427-loaded 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

Type Nano Material
Formula
Role core
2

adenovirus core complex-derived Mu peptide

adenovirus-derived Mu peptide
Type Biomolecule
Formula
Role layer
3

hyaluronic acid

HA
Type Biomolecule
Formula
Role layer

Properties

Applications

Area Application Source
medicine/veterinary

0 more entry available to subscribers only.

Or, view sample content

Characterization

Method Source
scanning electron microscopy

0 more entry available to subscribers only.

Or, view sample content

Biological effects

Biological system Test details Source
human epidermal carcinoma KB cell tumor-bearing athymic nude mouse

1 more entry available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • 5'-TATATACTAGTCAGATATTACT-3' oligodeoxynucleotide
  1. LN3Z4EX7U810rP5pD9v862YSs3PNIdzE62e2pyL3oeSplO1dTvlaDtH4EboG51nzzYdmyG6f8xL52gUqpxdiXkeJgF0rAVcEvEZmqnT2nOGIfZaS
  2. ot1VwKfHkI5G59suCANoJpjlS
  3. 8Fm7ar
Product

hyaluronic acid-coated, Mu peptide-condensed, Dz-13/OGX-427-loaded 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial