Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

hyaluronic acid-coated, Mu peptide-condensed, Dz-13/OGX-427-loaded 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

Based on

1 Articles
2015 Most recent source




Type Nano Material
Role core

adenovirus core complex-derived Mu peptide

adenovirus-derived Mu peptide
Type Biomolecule
Role layer

hyaluronic acid

Type Biomolecule
Role layer



Area Application Source

Full content is available to subscribers only

To view content please choose from the following:


Method Source

Full content is available to subscribers only

To view content please choose from the following:

Biological effects

Biological system Test details Source

Full content is available to subscribers only

To view content please choose from the following:


Method 1

Type: Chemical synthesis
Starting materials
  • 5'-TATATACTAGTCAGATATTACT-3' oligodeoxynucleotide
  1. dDyx7TpCN9zSOncCFiJKTA7HI88kDLVkEJ9nBhOHoDlLuCQmLV3j1cI2jUMOCILuytlGNQDLDMD0Ber85wh9BFMqUKcJMrt8gpJHiSy849svHsIE
  2. LKapzmLbLWSfVMVLS9wA3fNoA
  3. gHo2g3

hyaluronic acid-coated, Mu peptide-condensed, Dz-13/OGX-427-loaded 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs


Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial