Loading ...

Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

hyaluronic acid-coated, Mu peptide-condensed 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

Based on

1 Articles
2015 Most recent source

Composition

1

5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' single-stranded DNA

Type Biomolecule
Formula
Role core
2

adenovirus core complex-derived Mu peptide

adenovirus-derived Mu peptide
Type Biomolecule
Formula
Role layer
3

hyaluronic acid

HA
Type Biomolecule
Formula
Role layer

Properties

Applications

Area Application Nanomaterial Variant Source
drug delivery

More information available to subscribers only.

Or, view sample content

Characterization

Biological effects

Biological system Test details Nanomaterial Variant Source
human epidermal carcinoma KB cell tumor-bearing athymic nude mouse

More information/entries available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Chemical synthesis
Source:
Starting materials
  • 5'-TATATACTAGTCAGATATTACT-3' oligodeoxynucleotide
  1. ZvE70azG0Pt5hES0wfroNkGPSZjfiO4wJRXXL94EQ4xFkqgdm9if55QbRVSmQCkxHBfA7LA99tokxDYsQcOfcgqReknM81i5yowhxkWUFx4AUzjt
  2. mV3fQhzL42tbLdn6WbKH9ciY9
  3. M8tN4v
Product

hyaluronic acid-coated, Mu peptide-condensed 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

Size: not specified

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial