Loading ...

Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

Dz-13/OGX-427-loaded, Cy5-dCTP-incorporated 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' DNA nanoballs

Based on

1 Articles
2015 Most recent source

Composition

1

Cy5-labeled 5'-(TATATACTAGTCAGATATTACTATGACCGAGTGCCGCGTCCCACTACACTTCCAACGCCTTTTCCTCCCG)n-3' single-stranded DNA

Type Biomolecule
Formula
Role carriers
2

5'-CGGGAGGAAAAGGCGTTG-3' oligodeoxynucleotide

antisense oligonucleotide Dz-13 antisense oligonucleotide Dz13 DNAzyme Dz-13 ASO Dz-13 ASO Dz13 Dz-13 Dz13
Type Biomolecule
Formula
Role loaded material
3

5'-GGGACGCGGCACTCGGTCAT-3' oligodeoxynucleotide

antisense oligonucleotide OGX-427 ASO OGX-427 OGX-427
Type Biomolecule
Formula
Role loaded material

Properties

Applications

Characterization

Biological effects

Preparation

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial