Loading ...

RNA nanostructures

Based on

3 Articles
2017 Most recent source

Composition

1

5'-r(GGGAAUUCCUAACAGACCGACGUGAAGCAGGCACGCGUUGGUCUGGACAGCGGUAUGGUGAACGUGGUACGCCAUGCCGCUGGAGUUCCCU)-3'

Type Biomolecule
Formula
Role framework element
2

5'-r(GGGAAUUCGACGUCGCUGCAGUUCCUGGACCACGUGAAGCCUGCACGCGUGGUUCAGGGACUGCUAACAGAUCAUCGUACGCAACGGUGAAGAACGCACGCCGUUAGCGUGCGAUGGUCUGGACAGCGGCGUCGAGCCAAGGUGU)-3'

Type Biomolecule
Formula
Role framework element
3

5'-r(GGGGAGGGAAACGUGGCGGCUUGGCUGAAUGAAGCGUUCACGUUCAGCCAAGGGAAGAAACUGCGCCACGCCGAGGGAAGAAACUGCGACGUGAAGCCUCCACGCGUCGGCUCGGUCUCCCCU)-3'

Type Biomolecule
Formula
Role framework element
4

5'-r(GGGAAUUCGAGGACUGGUCUGGACAGCGACUGAAGGAGGCACGGUCGCUGCAGGCAUGAAGCUCGCACGUGCUUGCUAACAGAUCAGUUCUCGAGCCUUGGUGU)-3'

Type Biomolecule
Formula
Role framework element
5

5'-r(GGGGAGGGAAACGUGGCGGCUUGGCUGAAUGAAGGUGACACGUUCAGCCAAGGGAAGAAACUGCGCCACGCCGAGGGAAGAAACUGCGACGUGAAGCGAGCACGCGUCGGCUCGGUCUCCCCU)-3'

Type Biomolecule
Formula
Role framework element
6

5'-r(GGAAGGGAAACGUACCGGAUCAACGUACGCAACGGUGAAGUCACCACGCCGUUAGCGUGCGUUGGUCUGGUACGCUAAGCUGAGACCACGUGAGACCACGACGCGUGGUUUCAGUAUGUCUUCUU)-3'

Type Biomolecule
Formula
Role framework element

Properties

General physical and chemical properties

Property Value Nanomaterial Variant Source
melting point

More information available to subscribers only.

Or, view sample content

Applications

Area Application Nanomaterial Variant Source
diagnostics

More information/entries available to subscribers only.

Or, view sample content

Characterization

Method Nanomaterial Variant Source
atomic force microscopy

More information/entries available to subscribers only.

Or, view sample content

Biological effects

Biological system Test details Nanomaterial Variant Source
CCRF-CEM cells

More information/entries available to subscribers only.

Or, view sample content

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • 5'-r(GGGAAUUCGAGGACUGGUCUGGACAGCGACUGAAGGAGGCACGGUCGCUGCAGGCAUGAAGCUCGCACGUGCUUGCUAACAGAUCAGUUCUCGAGCCUUGGUGU)-3'
  • 5'-r(GGGAAUUCGACGUCGCUGCAGUUCCUGGACCACGUGAAGCCUGCACGCGUGGUUCAGGGACUGCUAACAGAUCAUCGUACGCAACGGUGAAGAACGCACGCCGUUAGCGUGCGAUGGUCUGGACAGCGGCGUCGAGCCAAGGUGU)-3'
  • 5'-r(GGAAGGGAAACGUACCGGAUCAACGUACGCAACGGUGAAGUCACCACGCCGUUAGCGUGCGUUGGUCUGGUACGCUAAGCUGAGACCACGUGAGACCACGACGCGUGGUUUCAGUAUGUCUUCUU)-3'
See all (6)
  1. bF3X6py1FOF29h
Product

RNA nanostructures

Length: ~ 25.8 nm

Width: ~ 23.8 nm

Medium/Support: none

Method 2

Type: Physical formation
Source:
Starting materials
  • 5'-r(GGGACAGGGAAACGUGAGACCGUUGGCUUGGCAAUUGUGAAGUCCACACGCAAUUAGCCAAGCUAACGGUCUCACGCCGAUCCUUGAGGUCGUGAAGCCUGCACGCGAUCUCAAGGAUCGGUCUGUCCUU)-3'
  • 5'-r(GGGGAGGGAAACGUGGCGGCUUGGCUGAAUGAAGUGGACACGUUCAGCCAAGGGAAGAAACUGCGCCACGCCGAGGGAAGAAACUGCGACGUGAAGCCUCCACGCGUCGGCUCGGUCUCCCCU)-3'
  • 5'-r(GGGACCUCCGUGGUUCGAAUCCACGUACUAGCCUGGAUGAAUUCCCAGUGAAGCAGGCACGCUGGGAGUUCGUCCAGGCUGGUAUGGCCGAGCGGCUGAAGGCACUCCGACGCGGUCUGCGCUGAAGCAGGCACGGCGUAGGCCGCGUUGGAGUAGGUCCCU)-3'
See all (4)
  1. BcGCZwKAytdj98
Product

RNA nanostructures

Length: ~ 28.5 nm

Width: ~ 27.8 nm

Medium/Support: none

Method 3

Type: Physical formation
Source:
Starting materials
  • 5'-r(GGGACGGACAGCGUGCAUGGUGAAGUCCACACGCCAUGCACGCUGCAGACCGAACGUGAAGCCUGCACGCGUUCGGUCUGCUAACGUUCCU)-3'
  • 5'-r(GGGACGGACAGCGUGCAUGGUGAAGGAGGCACGCCAUGCACGCUGCAGACCGAACGUGAAGUGGACACGCGUUCGGUCUGCUAACGUUCCU)-3'
  • 5'-r(GGGACGGACAGCGUGCAUGGUGAAGCAGGCACGCCAUGCACGCUGCAGACCGAACGUGAAGCCUCCACGCGUUCGGUCUGCUAACGUUCCU)-3'
  1. OFJN02dAyKOfDF
Product

RNA nanostructures

Size: not specified

Medium/Support: none

Method 4

Type: Physical formation
Source:
Starting materials
  • DNA
  • oligonucleotide
  1. NfKJTt
  2. s28tMtcVogSjFsW70unNsyjnMaFm1z4wr9g5xZoeTDP264Iu
  3. 1kWU
Product

RNA nanostructures

Size: ~ 200 nm

Medium/Support: none

Method 5

Type: Physical formation
Source:
Starting materials
  • DNA
  • oligonucleotide
  1. vNSVm4
  2. Tujk7jx6mACwu6wpvnsZlKtzEB4NhNL1xgx29qsx53wOQAVV
  3. uZGM
Product

RNA nanostructures

Size: ~ 200 nm

Medium/Support: none

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial