Fast insight into nanotechnology

Access easily searchable nanoscience data, synthesis methods and literature

DNA nanocages

Based on

1 Articles
2015 Most recent source

Composition

1

GATCACCAACGGAAGTTTTTCTTGCCAGGCACCATCGTAGGTTTTTCGTTCCGATCACCAACGGAAGTTTTTCTTGCCAGGCACCATCGTAGGTTTTTCGTTCC

Type Biomolecule
Formula
Role raw materials
2

TTACCGTGTGGTTGCACAGAG

Type Biomolecule
Formula
Role raw materials
3

GCTGTTCGTGGCGCTATTCGG

Type Biomolecule
Formula
Role raw materials
4

TGCAACCTGCCTGGCAAGCTTCCGTTGGACGAACAGCTGAC

Type Biomolecule
Formula
Role raw materials
5

TAGCGCCTGATCGGAACGCCTACGATGGACACGGTAACGCC

Type Biomolecule
Formula
Role raw materials
6

TAGCAACCTGCCTGGCAAGCCTACGATGGACACGGTAACTCT

Type Biomolecule
Formula
Role raw materials
7

GCCAGGCACCATCGTAGGCTTTTCCTCAAGA

Type Biomolecule
Formula
Role raw materials
8

TTACCGTGTGGTTGCTAGGCG

Type Biomolecule
Formula
Role raw materials
9

ATAGCGCCTGATCGGAACGCCTACGATGGACACGGTAACGAC

Type Biomolecule
Formula
Role raw materials
10

TCCGATCACCAACGGAAGCGATTCCTCAAGA

Type Biomolecule
Formula
Role raw materials
11

TCCTAGCACCATCGTAGGCGTTTCCTCAAGA

Type Biomolecule
Formula
Role raw materials
12

GCTGTTCGTGGCGCTATGTCA

Type Biomolecule
Formula
Role raw materials
13

TTACCGTGTGGGCTCAGCAGT

Type Biomolecule
Formula
Role raw materials
14

GGAGCTTTTTCGATCCTAGCACCTCTGGAGCTTTTTCGATCCTAGCACCTCT GGAGCTTTTTCGATCCTAGCACCTCT

Type Biomolecule
Formula
Role raw materials
15

CTGAGCCCTGCTAGGATCGGCTCCAGAGGACTACTCATACTG

Type Biomolecule
Formula
Role raw materials
16

ATGAGTAGTGGGCTCAGGTCG

Type Biomolecule
Formula
Role raw materials
17

CTGAGCCCTGCTAGGATCGCTTCCGTTGGACGAACAGCCCGA

Type Biomolecule
Formula
Role raw materials

Properties

Applications

Characterization

Biological effects

Preparation

Method 1

Type: Physical formation
Source:
Starting materials
  • TGCAACCTGCCTGGCAAGCTTCCGTTGGACGAACAGCTGAC
  • TTACCGTGTGGTTGCACAGAG
  • GCTGTTCGTGGCGCTATGTCA
See all (17)
  1. p4Y9g
  2. qcCF
  3. 0HiVc1tBdyS
  4. TDf3
  5. pkOGQjo91V9d97OYd
  6. BE0m
Product

DNA nanocages

References

Full content is available to subscribers only

To view content please choose from the following:

We use cookies to improve your experience with our site. More information

Sign up for a free trial